SZGR2

Summary ?

GeneID	9228
Symbol	DLGAP2
Synonyms	DAP2\|SAPAP2
Description	discs large homolog associated protein 2
Reference	MIM:605438\|HGNC:HGNC:2906\|Ensembl:ENSG00000198010\|HPRD:09258\|Vega:OTTHUMG00000163599
Gene type	protein-coding
Map location	8p23
Pascal p-value	0.127
Sherlock p-value	0.983
Fetal beta	-2.177
DMG	2 (# studies)
Support	PROTEIN CLUSTERING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome G2Cdb.human_TAP-PSD-95-CORE G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg23042540	8	1653566	DLGAP2	3.598E-4	-0.324	0.042	DMG:Wockner_2014
cg25633955	8	1616622	DLGAP2	1.03E-7	0.025	2.28E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
EIF6	0.88	0.89
EBP	0.88	0.87
TBCB	0.88	0.88
DCTPP1	0.87	0.87
DCTN3	0.86	0.86
DCTN2	0.86	0.88
EEF1B2	0.85	0.84
PSMA7	0.85	0.86
EIF2B3	0.85	0.89
PSMD13	0.85	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.26	-0.68	-0.80
MT-CYB	-0.68	-0.76
AF347015.8	-0.67	-0.75
AF347015.15	-0.67	-0.77
AF347015.2	-0.67	-0.76
AF347015.33	-0.67	-0.75
AF347015.27	-0.66	-0.75
MT-CO2	-0.66	-0.72
AF347015.31	-0.65	-0.72
AF347015.9	-0.62	-0.73

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	NAS		10759891
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007270	nerve-nerve synaptic transmission	NAS	neuron, Synap (GO term level: 7)	9694864
GO:0007267	cell-cell signaling	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005883	neurofilament	NAS	neuron, axon (GO term level: 11)	10759891
GO:0045211	postsynaptic membrane	IEA	Synap, Neurotransmitter (GO term level: 5)	-
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005886	plasma membrane	IEA		-
GO:0030054	cell junction	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP	195	138	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN	165	106	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	945	951	1A	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	945	951	1A	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-124.1	1837	1843	1A	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-129-5p	1857	1863	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
				hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-135	2651	2657	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	2651	2657	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-153	1117	1123	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-17-5p/20/93.mr/106/519.d	1567	1574	1A,m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-181	1871	1877	1A	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-182	6428	6434	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-217	1119	1126	1A,m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-23	1034	1040	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1034	1040	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-25/32/92/363/367	2596	2603	1A,m8	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-323	1034	1040	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-326	1943	1949	m8	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-33	1889	1895	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	1889	1895	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-381	5688	5694	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-450	1892	1898	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-450	1892	1898	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-9	2515	2521	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-96	6427	6434	1A,m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DLGAP2