Gene Page: HAND1
Summary ?
GeneID | 9421 |
Symbol | HAND1 |
Synonyms | Hxt|Thing1|bHLHa27|eHand |
Description | heart and neural crest derivatives expressed 1 |
Reference | MIM:602406|HGNC:HGNC:4807|Ensembl:ENSG00000113196|HPRD:03871|Vega:OTTHUMG00000130193 |
Gene type | protein-coding |
Map location | 5q33 |
Pascal p-value | 0.015 |
Fetal beta | -0.384 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg25587535 | 5 | 153857846 | HAND1 | 2.288E-4 | -0.255 | 0.036 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MAVS | 0.89 | 0.88 |
NUP210 | 0.87 | 0.87 |
EIF2C1 | 0.87 | 0.82 |
SP1 | 0.87 | 0.84 |
MAML1 | 0.86 | 0.83 |
ZNF516 | 0.86 | 0.87 |
PDPR | 0.85 | 0.84 |
FAM53B | 0.84 | 0.86 |
CTDSP2 | 0.84 | 0.85 |
KIAA0355 | 0.84 | 0.84 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.48 | -0.55 |
AF347015.21 | -0.47 | -0.64 |
C5orf53 | -0.47 | -0.50 |
RERGL | -0.47 | -0.61 |
IFI27 | -0.46 | -0.50 |
GMFG | -0.46 | -0.60 |
C1orf54 | -0.46 | -0.60 |
SYCP3 | -0.46 | -0.58 |
CARD16 | -0.45 | -0.56 |
MYL3 | -0.45 | -0.53 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 9931445 | |
GO:0008134 | transcription factor binding | IEA | - | |
GO:0016564 | transcription repressor activity | IEA | - | |
GO:0042803 | protein homodimerization activity | IEA | - | |
GO:0046982 | protein heterodimerization activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0001525 | angiogenesis | IEA | - | |
GO:0001707 | mesoderm formation | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007507 | heart development | TAS | 9931445 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BIOCARTA NFAT PATHWAY | 56 | 45 | All SZGR 2.0 genes in this pathway |
MAHADEVAN IMATINIB RESISTANCE DN | 20 | 11 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA PROGRESSION RISK | 74 | 44 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION 12HR | 43 | 35 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
SHETH LIVER CANCER VS TXNIP LOSS PAM5 | 94 | 59 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
NOUZOVA METHYLATED IN APL | 68 | 39 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
XU GH1 EXOGENOUS TARGETS UP | 85 | 50 | All SZGR 2.0 genes in this pathway |
XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 744 | 751 | 1A,m8 | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-196 | 684 | 691 | 1A,m8 | hsa-miR-196a | UAGGUAGUUUCAUGUUGUUGG |
hsa-miR-196b | UAGGUAGUUUCCUGUUGUUGG | ||||
miR-25/32/92/363/367 | 175 | 181 | m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA | ||||
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-33 | 431 | 437 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
miR-335 | 803 | 810 | 1A,m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
miR-363 | 174 | 180 | m8 | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.