Gene Page: GDA
Summary ?
GeneID | 9615 |
Symbol | GDA |
Synonyms | CYPIN|GUANASE|NEDASIN |
Description | guanine deaminase |
Reference | MIM:139260|HGNC:HGNC:4212|Ensembl:ENSG00000119125|HPRD:08849|Vega:OTTHUMG00000020005 |
Gene type | protein-coding |
Map location | 9q21.13 |
Pascal p-value | 0.002 |
Fetal beta | -3.8 |
eGene | Hypothalamus |
Support | CELL METABOLISM G2Cdb.human_TAP-PSD-95-CORE Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CEP68 | 0.91 | 0.94 |
UBN1 | 0.90 | 0.94 |
KSR1 | 0.90 | 0.92 |
SRGAP3 | 0.90 | 0.94 |
POM121 | 0.90 | 0.92 |
POM121C | 0.89 | 0.93 |
LARP4B | 0.89 | 0.93 |
BICD2 | 0.89 | 0.93 |
TBC1D24 | 0.89 | 0.93 |
TGFBRAP1 | 0.89 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.31 | -0.65 | -0.71 |
MT-CO2 | -0.65 | -0.72 |
FXYD1 | -0.64 | -0.68 |
AF347015.21 | -0.63 | -0.77 |
HIGD1B | -0.63 | -0.70 |
C1orf54 | -0.62 | -0.80 |
AC021016.1 | -0.62 | -0.68 |
S100B | -0.62 | -0.67 |
AF347015.33 | -0.61 | -0.65 |
MT-CYB | -0.61 | -0.66 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016787 | hydrolase activity | IEA | - | |
GO:0008892 | guanine deaminase activity | EXP | 10075721 | |
GO:0008892 | guanine deaminase activity | IEA | - | |
GO:0008892 | guanine deaminase activity | TAS | 10075721 | |
GO:0008270 | zinc ion binding | TAS | 10075721 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 10542258 |
GO:0006139 | nucleobase, nucleoside, nucleotide and nucleic acid metabolic process | TAS | 10075721 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 10075721 | |
GO:0005622 | intracellular | TAS | 10542258 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PURINE METABOLISM | 159 | 96 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF NUCLEOTIDES | 72 | 45 | All SZGR 2.0 genes in this pathway |
REACTOME PURINE CATABOLISM | 10 | 6 | All SZGR 2.0 genes in this pathway |
REACTOME PURINE METABOLISM | 33 | 24 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
RODRIGUES NTN1 TARGETS DN | 158 | 102 | All SZGR 2.0 genes in this pathway |
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP | 137 | 84 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER E | 89 | 44 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
WANG IMMORTALIZED BY HOXA9 AND MEIS1 UP | 31 | 24 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
COATES MACROPHAGE M1 VS M2 UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION UP | 180 | 114 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN | 170 | 105 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
ZEMBUTSU SENSITIVITY TO NIMUSTINE | 17 | 13 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION TOP20 UP | 20 | 14 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP | 271 | 165 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
ALTEMEIER RESPONSE TO LPS WITH MECHANICAL VENTILATION | 128 | 81 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 80 | 86 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-130/301 | 569 | 575 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-19 | 568 | 574 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-485-3p | 3800 | 3806 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-505 | 2146 | 2153 | 1A,m8 | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.