SZGR2

Summary ?

GeneID	9869
Symbol	SETDB1
Synonyms	ESET\|H3-K9-HMTase4\|KG1T\|KMT1E\|TDRD21
Description	SET domain bifurcated 1
Reference	MIM:604396\|HGNC:HGNC:10761\|Ensembl:ENSG00000143379\|HPRD:06828\|Vega:OTTHUMG00000035003
Gene type	protein-coding
Map location	1q21
Sherlock p-value	0.382
Fetal beta	1.716
eGene	Myers' cis & trans
Support	Ascano FMRP targets Chromatin Remodeling Genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0235
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00814
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.125

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16955618	chr15	29937543	SETDB1	9869		0.2		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
WDR6	0.96	0.96
DCAF15	0.96	0.94
MTA1	0.95	0.95
VPS16A	0.94	0.93
AXIN1	0.94	0.94
RBM15B	0.94	0.93
PABPC4	0.94	0.91
EHMT2	0.94	0.94
CNTROB	0.93	0.96
CHFR	0.93	0.95

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.78	-0.87
AF347015.27	-0.78	-0.88
MT-CO2	-0.76	-0.87
C5orf53	-0.75	-0.77
AF347015.33	-0.75	-0.85
MT-CYB	-0.74	-0.84
AF347015.8	-0.73	-0.85
S100B	-0.72	-0.79
HLA-F	-0.72	-0.73
COPZ2	-0.71	-0.77

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0005515	protein binding	IPI		11791185 \|16682412 \|17577629
GO:0016740	transferase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0008168	methyltransferase activity	IEA		-
GO:0018024	histone-lysine N-methyltransferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0016568	chromatin modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005694	chromosome	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AIFM1	AIF \| MGC111425 \| PDCD8	apoptosis-inducing factor, mitochondrion-associated, 1	Two-hybrid	BioGRID	16169070
AOF2	BHC110 \| KDM1 \| KIAA0601 \| LSD1	amine oxidase (flavin containing) domain 2	Two-hybrid	BioGRID	16169070
ASAH1	AC \| ASAH \| FLJ21558 \| FLJ22079 \| PHP \| PHP32	N-acylsphingosine amidohydrolase (acid ceramidase) 1	Two-hybrid	BioGRID	16169070
ATF7IP	FLJ10139 \| FLJ10688 \| MCAF \| p621	activating transcription factor 7 interacting protein	-	HPRD	14536086
ATF7IP	FLJ10139 \| FLJ10688 \| MCAF \| p621	activating transcription factor 7 interacting protein	MCAF1 interacts with SETDB1.	BIND	15691849
ATF7IP2	FLJ12668 \| MCAF2	activating transcription factor 7 interacting protein 2	MCAF2 interacts with SETDB1.	BIND	15691849
BAT3	BAG-6 \| BAG6 \| D6S52E \| G3	HLA-B associated transcript 3	Two-hybrid	BioGRID	16169070
BHLHB2	DEC1 \| SHARP-2 \| STRA13 \| Stra14 \| bHLHe40	basic helix-loop-helix domain containing, class B, 2	Two-hybrid	BioGRID	16169070
BTBD2	-	BTB (POZ) domain containing 2	Two-hybrid	BioGRID	16169070
BXDC2	BRIX \| FLJ11100	brix domain containing 2	Two-hybrid	BioGRID	16169070
C11orf1	FLJ23499	chromosome 11 open reading frame 1	Two-hybrid	BioGRID	16169070
CBX8	HPC3 \| PC3 \| RC1	chromobox homolog 8 (Pc class homolog, Drosophila)	Two-hybrid	BioGRID	16169070
CCDC106	HSU79303 \| ZNF581	coiled-coil domain containing 106	Two-hybrid	BioGRID	16169070
CDK4	CMM3 \| MGC14458 \| PSK-J3	cyclin-dependent kinase 4	Two-hybrid	BioGRID	16169070
CHAF1A	CAF-1 \| CAF1 \| CAF1B \| CAF1P150 \| MGC71229 \| P150	chromatin assembly factor 1, subunit A (p150)	SETDB1 interacts with CAF-1.	BIND	15327775
CLSTN1	ALC-ALPHA \| CSTN1 \| FLJ32258 \| KIAA0911 \| PIK3CD \| XB31alpha \| alcalpha1 \| alcalpha2	calsyntenin 1	-	HPRD	12421765
CRELD1	AVSD2 \| CIRRIN \| DKFZp566D213	cysteine-rich with EGF-like domains 1	Two-hybrid	BioGRID	16169070
DAP	MGC99796	death-associated protein	Two-hybrid	BioGRID	16169070
DLEU1	BCMS \| DLB1 \| DLEU2 \| LEU1 \| LEU2 \| MGC22430 \| NCRNA00021 \| XTP6	deleted in lymphocytic leukemia 1 (non-protein coding)	Two-hybrid	BioGRID	16169070
ECSIT	SITPEC	ECSIT homolog (Drosophila)	Two-hybrid	BioGRID	16169070
ERH	DROER \| FLJ27340	enhancer of rudimentary homolog (Drosophila)	Two-hybrid	BioGRID	16169070
FLYWCH1	-	FLYWCH-type zinc finger 1	Two-hybrid	BioGRID	16169070
GIPC2	FLJ20075 \| SEMCAP-2 \| SEMCAP2	GIPC PDZ domain containing family, member 2	Two-hybrid	BioGRID	16169070
GPS2	AMF-1 \| MGC104294 \| MGC119287 \| MGC119288 \| MGC119289	G protein pathway suppressor 2	Two-hybrid	BioGRID	16169070
GSTO1	DKFZp686H13163 \| GSTTLp28 \| P28	glutathione S-transferase omega 1	Two-hybrid	BioGRID	16169070
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD	12398767
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Affinity Capture-Western	BioGRID	12398767
HIST2H3A	H3/n \| H3/o	histone cluster 2, H3a	Reconstituted Complex	BioGRID	11959841
HIST4H4	H4/p \| MGC24116	histone cluster 4, H4	Reconstituted Complex	BioGRID	11959841
HMOX2	HO-2	heme oxygenase (decycling) 2	Two-hybrid	BioGRID	16169070
HSPB3	HSPL27	heat shock 27kDa protein 3	Two-hybrid	BioGRID	16169070
MAD2L1BP	CMT2 \| KIAA0110 \| MGC11282 \| RP1-261G23.6	MAD2L1 binding protein	Two-hybrid	BioGRID	16169070
MBD1	CXXC3 \| PCM1 \| RFT	methyl-CpG binding domain protein 1	MBD1 interacts with SETDB1.	BIND	15327775
MOBKL3	2C4D \| CGI-95 \| MGC12264 \| MOB1 \| MOB3 \| PREI3	MOB1, Mps One Binder kinase activator-like 3 (yeast)	Two-hybrid	BioGRID	16169070
MRPL44	FLJ12701 \| FLJ13990 \| FLJ37688 \| L44MT \| MRP-L44	mitochondrial ribosomal protein L44	Two-hybrid	BioGRID	16169070
NIPSNAP3A	DKFZp564D177 \| FLJ13953 \| HSPC299 \| MGC14553 \| NIPSNAP4 \| TASSC	nipsnap homolog 3A (C. elegans)	Two-hybrid	BioGRID	16169070
OLFML3	HNOEL-iso \| OLF44	olfactomedin-like 3	Two-hybrid	BioGRID	16169070
ORAI2	C7orf19 \| CBCIP2 \| FLJ12474 \| FLJ14733 \| FLJ44818 \| TMEM142B	ORAI calcium release-activated calcium modulator 2	Two-hybrid	BioGRID	16169070
PAFAH1B3	-	platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa	Two-hybrid	BioGRID	16169070
PCDHA4	CNR1 \| CNRN1 \| CRNR1 \| MGC138307 \| MGC142169 \| PCDH-ALPHA4	protocadherin alpha 4	Two-hybrid	BioGRID	16169070
PGAM5	BXLBv68 \| MGC5352	phosphoglycerate mutase family member 5	Two-hybrid	BioGRID	16169070
PHF10	FLJ10975 \| MGC111009 \| XAP135	PHD finger protein 10	Two-hybrid	BioGRID	16169070
PLEKHA4	PEPP1	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	Two-hybrid	BioGRID	16169070
POLA2	FLJ21662 \| FLJ37250	polymerase (DNA directed), alpha 2 (70kD subunit)	Two-hybrid	BioGRID	16169070
PPA1	IOPPP \| MGC111556 \| PP \| PP1 \| SID6-8061	pyrophosphatase (inorganic) 1	Two-hybrid	BioGRID	16169070
PPP1R8	ARD-1 \| ARD1 \| NIPP-1 \| NIPP1 \| PRO2047	protein phosphatase 1, regulatory (inhibitor) subunit 8	Two-hybrid	BioGRID	16169070
PRKRA	DYT16 \| HSD14 \| PACT \| RAX	protein kinase, interferon-inducible double stranded RNA dependent activator	Two-hybrid	BioGRID	16169070
PSMD11	MGC3844 \| Rpn6 \| S9 \| p44.5	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	Two-hybrid	BioGRID	16169070
PTPRS	PTPSIGMA	protein tyrosine phosphatase, receptor type, S	Two-hybrid	BioGRID	16169070
QTRT1	FP3235 \| TGT	queuine tRNA-ribosyltransferase 1	Two-hybrid	BioGRID	16169070
RNF10	KIAA0262 \| MGC126758 \| MGC126764 \| RIE2	ring finger protein 10	Two-hybrid	BioGRID	16169070
S100A10	42C \| ANX2L \| ANX2LG \| CAL1L \| CLP11 \| Ca[1] \| GP11 \| MGC111133 \| P11 \| p10	S100 calcium binding protein A10	Two-hybrid	BioGRID	16169070
SAT1	DC21 \| KFSD \| SAT \| SSAT \| SSAT-1	spermidine/spermine N1-acetyltransferase 1	Two-hybrid	BioGRID	16169070
SERPINB9	CAP-3 \| CAP3 \| PI9	serpin peptidase inhibitor, clade B (ovalbumin), member 9	Two-hybrid	BioGRID	16169070
SIN3A	DKFZp434K2235 \| FLJ90319 \| KIAA0700	SIN3 homolog A, transcription regulator (yeast)	-	HPRD,BioGRID	12398767
SIN3B	KIAA0700	SIN3 homolog B, transcription regulator (yeast)	-	HPRD,BioGRID	12398767
SLC38A3	G17 \| NAT1 \| SN1	solute carrier family 38, member 3	Two-hybrid	BioGRID	16169070
SULT1E1	EST \| EST-1 \| MGC34459 \| STE	sulfotransferase family 1E, estrogen-preferring, member 1	Two-hybrid	BioGRID	16169070
SUZ12	CHET9 \| JJAZ1 \| KIAA0160	suppressor of zeste 12 homolog (Drosophila)	Co-purification	BioGRID	14536086
TARDBP	ALS10 \| TDP-43	TAR DNA binding protein	Two-hybrid	BioGRID	16169070
TCERG1	CA150 \| MGC133200 \| TAF2S	transcription elongation regulator 1	-	HPRD	15383276
THAP8	FLJ32891	THAP domain containing 8	Two-hybrid	BioGRID	16169070
TK1	TK2	thymidine kinase 1, soluble	Two-hybrid	BioGRID	16169070
TOB1	APRO6 \| MGC104792 \| MGC34446 \| PIG49 \| TOB \| TROB \| TROB1	transducer of ERBB2, 1	Two-hybrid	BioGRID	16169070
TOLLIP	FLJ33531 \| IL-1RAcPIP	toll interacting protein	Two-hybrid	BioGRID	16169070
TPI1	MGC88108 \| TPI	triosephosphate isomerase 1	Two-hybrid	BioGRID	16169070
TRBV2	TCRBV22S1A2N1T \| TCRBV2S1	T cell receptor beta variable 2	Two-hybrid	BioGRID	16169070
TRDMT1	DNMT2 \| M.HsaIIP \| PuMet \| RNMT1	tRNA aspartic acid methyltransferase 1	Two-hybrid	BioGRID	16169070
TRIB3	C20orf97 \| NIPK \| SINK \| SKIP3 \| TRB3	tribbles homolog 3 (Drosophila)	Two-hybrid	BioGRID	16169070
TRIM28	FLJ29029 \| KAP1 \| RNF96 \| TF1B \| TIF1B	tripartite motif-containing 28	-	HPRD,BioGRID	11959841
TSC22D1	DKFZp686O19206 \| MGC17597 \| RP11-269C23.2 \| TGFB1I4 \| TSC22	TSC22 domain family, member 1	Two-hybrid	BioGRID	16169070
TTR	HsT2651 \| PALB \| TBPA	transthyretin	Two-hybrid	BioGRID	16169070
TXNDC9	APACD	thioredoxin domain containing 9	Two-hybrid	BioGRID	16169070
ULK2	KIAA0623 \| Unc51.2	unc-51-like kinase 2 (C. elegans)	Two-hybrid	BioGRID	16169070
USP11	UHX1	ubiquitin specific peptidase 11	Two-hybrid	BioGRID	16169070
ZFP64	MGC940 \| ZNF338	zinc finger protein 64 homolog (mouse)	Two-hybrid	BioGRID	16169070
ZNF24	KOX17 \| RSG-A \| ZNF191 \| ZSCAN3 \| Zfp191	zinc finger protein 24	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG LYSINE DEGRADATION	44	29	All SZGR 2.0 genes in this pathway
PID WNT NONCANONICAL PATHWAY	32	26	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN	335	193	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
KAMMINGA EZH2 TARGETS	41	26	All SZGR 2.0 genes in this pathway
NOUZOVA TRETINOIN AND H4 ACETYLATION	143	85	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN	98	67	All SZGR 2.0 genes in this pathway
BACOLOD RESISTANCE TO ALKYLATING AGENTS DN	60	45	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
LIN MELANOMA COPY NUMBER UP	73	53	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 UP	113	70	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS UP	504	321	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 36HR	152	88	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-28	107	114	1A,m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-29	159	166	1A,m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SETDB1