Gene Page: C14orf100

Summary
GeneID  51528
Symbol  C14orf100
Synonyms  CDA06|HSPC213|HSPC327|JAMP
Description  chromosome 14 open reading frame 100
See related  HGNC:20184|MIM:611176|Ensembl:ENSG00000050130|HPRD:12623|
Locus tag  -
Gene type  protein-coding
Map location  14q23.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.959 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
LIANG_HEMATOPOIESIS_STEM_CELL_NUMBER_LARGE_VS_TINY_UP 4424All SZGR genes in this pathway
WEI_MYCN_TARGETS_WITH_E_BOX 795478All SZGR genes in this pathway
STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN 517309All SZGR genes in this pathway
GUO_HEX_TARGETS_DN 6536All SZGR genes in this pathway
DOUGLAS_BMI1_TARGETS_DN 314188All SZGR genes in this pathway
STEARMAN_LUNG_CANCER_EARLY_VS_LATE_UP 12589All SZGR genes in this pathway
MASSARWEH_TAMOXIFEN_RESISTANCE_UP 578341All SZGR genes in this pathway
MOLENAAR_TARGETS_OF_CCND1_AND_CDK4_DN 5825All SZGR genes in this pathway
ACEVEDO_LIVER_CANCER_UP 973570All SZGR genes in this pathway
MILI_PSEUDOPODIA_HAPTOTAXIS_DN 668419All SZGR genes in this pathway
PILON_KLF1_TARGETS_DN 19721213All SZGR genes in this pathway
FEVR_CTNNB1_TARGETS_UP 682433All SZGR genes in this pathway
RAO_BOUND_BY_SALL4_ISOFORM_A 182108All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-18217231Ahsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-4105415471Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-9617231Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.