SZGR2

Summary ?

GeneID	10006
Symbol	ABI1
Synonyms	ABI-1\|ABLBP4\|E3B1\|NAP1BP\|SSH3BP\|SSH3BP1
Description	abl interactor 1
Reference	MIM:603050\|HGNC:HGNC:11320\|Ensembl:ENSG00000136754\|HPRD:04336\|Vega:OTTHUMG00000017848
Gene type	protein-coding
Map location	10p11.2
Pascal p-value	0.004
Fetal beta	-0.74
eGene	Myers' cis & trans Meta
Support	STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs2716734	chr2	39947720	ABI1	10006	1.834E-6	trans
rs2716736	chr2	39947946	ABI1	10006	1.834E-6	trans
rs6446391	chr4	5695478	ABI1	10006	0.17	trans
rs17023105	chr4	96074164	ABI1	10006	0.01	trans
rs10516959	chr4	96088848	ABI1	10006	0.11	trans
rs16869878	chr5	2523760	ABI1	10006	0.05	trans
rs467856	chr5	3128168	ABI1	10006	0.11	trans
snp_a-2169623		0	ABI1	10006	1.694E-5	trans
rs13175086	chr5	174691428	ABI1	10006	0.11	trans
rs17165806	chr7	93469599	ABI1	10006	0.05	trans
rs7777209	chr7	93485280	ABI1	10006	0.05	trans
snp_a-2308001		0	ABI1	10006	0.08	trans
rs870686	chr8	25253521	ABI1	10006	0.02	trans
rs10503771	chr8	25304019	ABI1	10006	0.02	trans
rs12255258	chr10	106306927	ABI1	10006	0.06	trans
rs11601862	chr11	76333269	ABI1	10006	0.2	trans
rs7298298	chr12	17810638	ABI1	10006	0.13	trans
rs2764585	chr13	46880234	ABI1	10006	0.19	trans
rs9590075	chr13	95414389	ABI1	10006	0.02	trans
rs1507047	chr16	50932778	ABI1	10006	0.18	trans
rs349973	chr17	50642288	ABI1	10006	0.01	trans
rs6128541	chr20	57917688	ABI1	10006	0.2	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008092	cytoskeletal protein binding	TAS		9593709
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	TAS		9010225
GO:0008285	negative regulation of cell proliferation	TAS		9010225
GO:0018108	peptidyl-tyrosine phosphorylation	IDA		17101133
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0019717	synaptosome	IEA	Synap, Brain (GO term level: 7)	-
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005829	cytosol	TAS		9010225
GO:0005856	cytoskeleton	IEA		-
GO:0005622	intracellular	IDA		17101133
GO:0005625	soluble fraction	TAS		9010225
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005783	endoplasmic reticulum	TAS		9593709
GO:0030027	lamellipodium	IDA		17101133
GO:0030054	cell junction	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD	9010225 \|12672821
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	hNap1BP interacts with Abl.	BIND	11418237
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	Affinity Capture-Western Reconstituted Complex	BioGRID	9010225 \|11418237 \|12672821
DNM2	CMTDI1 \| CMTDIB \| DI-CMTB \| DYN2 \| DYNII	dynamin 2	An unspecified isoform of Dyn2 interacts with Abi-1. This interaction was modeled on a demonstrated interaction between human Dyn2 and Abi-1 from an unspecified species.	BIND	15696170
ENAH	ENA \| MENA \| NDPP1	enabled homolog (Drosophila)	-	HPRD,BioGRID	12672821
EPS8	-	epidermal growth factor receptor pathway substrate 8	-	HPRD	1049958 \|9010225 \|11099046 \|12127568
EPS8	-	epidermal growth factor receptor pathway substrate 8	Affinity Capture-Western Reconstituted Complex	BioGRID	9010225 \|11099046 \|14565974
EPS8L1	DRC3 \| EPS8R1 \| FLJ20258 \| MGC23164 \| MGC4642 \| PP10566	EPS8-like 1	-	HPRD,BioGRID	14565974
EPS8L2	EPS8R2 \| FLJ16738 \| FLJ21935 \| FLJ22171 \| MGC126530 \| MGC3088	EPS8-like 2	Affinity Capture-Western	BioGRID	14565974
EPS8L3	EPS8R3 \| FLJ21522 \| MGC16817	EPS8-like 3	Affinity Capture-Western	BioGRID	14565974
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD	15048123
NCF1C	SH3PXD1C	neutrophil cytosolic factor 1C pseudogene	ABI-1 interacts with p47phox.	BIND	12681507
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD,BioGRID	11418237
NCK2	GRB4 \| NCKbeta	NCK adaptor protein 2	-	HPRD	11557983
NCKAP1	FLJ11291 \| HEM2 \| KIAA0587 \| MGC8981 \| NAP1 \| NAP125	NCK-associated protein 1	Affinity Capture-Western Two-hybrid	BioGRID	11418237
NCKAP1	FLJ11291 \| HEM2 \| KIAA0587 \| MGC8981 \| NAP1 \| NAP125	NCK-associated protein 1	Nap1 interacts with hNap1BP.	BIND	11418237
NIN	KIAA1565	ninein (GSK3B interacting protein)	-	HPRD	15048123
PAK2	PAK65 \| PAKgamma	p21 protein (Cdc42/Rac)-activated kinase 2	-	HPRD	11956071
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	-	HPRD,BioGRID	10499589
SOS2	FLJ25596	son of sevenless homolog 2 (Drosophila)	-	HPRD	11003655

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID ECADHERIN NASCENT AJ PATHWAY	39	33	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY	42	34	All SZGR 2.0 genes in this pathway
PID RAC1 REG PATHWAY	38	25	All SZGR 2.0 genes in this pathway
PID INTEGRIN A4B1 PATHWAY	33	24	All SZGR 2.0 genes in this pathway
PID RAC1 PATHWAY	54	37	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP	255	177	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
XU AKT1 TARGETS 6HR	27	18	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
KENNY CTNNB1 TARGETS UP	50	30	All SZGR 2.0 genes in this pathway
CHANG POU5F1 TARGETS UP	15	10	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-181	131	137	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ABI1