SZGR2

Summary ?

GeneID	10307
Symbol	APBB3
Synonyms	FE65L2\|SRA
Description	amyloid beta precursor protein binding family B member 3
Reference	MIM:602711\|HGNC:HGNC:20708\|Ensembl:ENSG00000113108\|HPRD:04089\|Vega:OTTHUMG00000129504
Gene type	protein-coding
Map location	5q31
Pascal p-value	3.065E-4
Sherlock p-value	0.652
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.0032

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs10409262	chr19	58154954	APBB3	10307		0.14		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MEN1	0.95	0.94
RANBP3	0.94	0.94
EHMT2	0.94	0.94
U2AF2	0.94	0.94
CNOT3	0.94	0.94
SMPD4	0.94	0.94
EDC4	0.94	0.94
ZNF384	0.94	0.95
UNK	0.94	0.95
ZNF777	0.93	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.78	-0.86
MT-CO2	-0.76	-0.86
AF347015.27	-0.75	-0.85
AF347015.21	-0.73	-0.91
MT-CYB	-0.72	-0.82
AF347015.33	-0.72	-0.81
AF347015.8	-0.72	-0.83
C5orf53	-0.71	-0.74
HIGD1B	-0.70	-0.79
IFI27	-0.70	-0.76

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	IPI		10081969
GO:0005515	protein binding	TAS		10081969
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007242	intracellular signaling cascade	NAS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	IDA		18029348
GO:0005575	cellular_component	ND		-
GO:0005737	cytoplasm	IDA		18029348
GO:0005737	cytoplasm	TAS		10081969

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LAIHO COLORECTAL CANCER SERRATED DN	86	47	All SZGR 2.0 genes in this pathway
PENG LEUCINE DEPRIVATION UP	142	93	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN	314	188	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES DN	210	141	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	259	266	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-142-5p	272	279	1A,m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: APBB3