Gene Page: CAMKK2
Summary ?
GeneID | 10645 |
Symbol | CAMKK2 |
Synonyms | CAMKK|CAMKKB |
Description | calcium/calmodulin-dependent protein kinase kinase 2 |
Reference | MIM:615002|HGNC:HGNC:1470|Ensembl:ENSG00000110931|HPRD:06467|Vega:OTTHUMG00000169156 |
Gene type | protein-coding |
Map location | 12q24.2 |
Pascal p-value | 0.02 |
Sherlock p-value | 0.681 |
DEG p-value | DEG:Maycox_2009:CC_BA10_fold_change=-1.16:CC_BA10_disease_P=0.0165:HBB_BA9_fold_change=-1.49:HBB_BA9_disease_P=0.0230 |
Fetal beta | -1.531 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans Meta |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Maycox_2009 | Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue | We included 51 genes whose expression changes are common between two schizophrenia cohorts. | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg13839391 | 12 | 121719066 | CAMKK2 | 1.052E-4 | 0.351 | 0.028 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs208296 | chr12 | 121600952 | CAMKK2 | 10645 | 0.13 | cis | ||
rs2071272 | chr12 | 121670791 | CAMKK2 | 10645 | 0.01 | cis | ||
rs2252304 | chr12 | 121673599 | CAMKK2 | 10645 | 0.05 | cis | ||
rs2567982 | chr12 | 121675713 | CAMKK2 | 10645 | 0 | cis | ||
rs1063843 | chr12 | 121681686 | CAMKK2 | 10645 | 0.18 | cis | ||
rs2288693 | chr12 | 121687473 | CAMKK2 | 10645 | 0.02 | cis | ||
rs2079965 | chr7 | 71227723 | CAMKK2 | 10645 | 0.14 | trans | ||
rs2567982 | chr12 | 121675713 | CAMKK2 | 10645 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005509 | calcium ion binding | IDA | 11395482 | |
GO:0005516 | calmodulin binding | TAS | 11395482 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004683 | calmodulin-dependent protein kinase activity | IEA | - | |
GO:0004713 | protein tyrosine kinase activity | TAS | 11395482 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000165 | MAPKKK cascade | TAS | 11395482 | |
GO:0019722 | calcium-mediated signaling | TAS | 11395482 | |
GO:0045941 | positive regulation of transcription | TAS | 11395482 | |
GO:0045859 | regulation of protein kinase activity | TAS | 11395482 | |
GO:0046777 | protein amino acid autophosphorylation | IDA | 11395482 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | TAS | 11395482 | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ADIPOCYTOKINE SIGNALING PATHWAY | 67 | 57 | All SZGR 2.0 genes in this pathway |
BIOCARTA CACAM PATHWAY | 16 | 11 | All SZGR 2.0 genes in this pathway |
PID VEGFR1 2 PATHWAY | 69 | 57 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER UP | 96 | 57 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO ANDROGEN UP | 29 | 21 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO FORSKOLIN UP | 23 | 17 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
LUCAS HNF4A TARGETS UP | 58 | 36 | All SZGR 2.0 genes in this pathway |
SCHLOSSER MYC TARGETS AND SERUM RESPONSE UP | 47 | 32 | All SZGR 2.0 genes in this pathway |
TOMLINS PROSTATE CANCER UP | 40 | 27 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
FALVELLA SMOKERS WITH LUNG CANCER | 80 | 52 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A DN | 103 | 71 | All SZGR 2.0 genes in this pathway |
RICKMAN METASTASIS DN | 261 | 155 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
STARK HYPPOCAMPUS 22Q11 DELETION UP | 53 | 40 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L1 G1 DN | 12 | 6 | All SZGR 2.0 genes in this pathway |
NELSON RESPONSE TO ANDROGEN UP | 86 | 61 | All SZGR 2.0 genes in this pathway |
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP | 151 | 100 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
FIRESTEIN CTNNB1 PATHWAY | 33 | 23 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3 UNMETHYLATED | 37 | 21 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-153 | 2849 | 2855 | m8 | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-25/32/92/363/367 | 1853 | 1859 | 1A | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-29 | 2717 | 2723 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-5p | 1987 | 1994 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-329 | 98 | 104 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-342 | 226 | 232 | m8 | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
miR-378 | 597 | 604 | 1A,m8 | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-9 | 2153 | 2160 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.