SZGR2

Summary ?

GeneID	10645
Symbol	CAMKK2
Synonyms	CAMKK\|CAMKKB
Description	calcium/calmodulin-dependent protein kinase kinase 2
Reference	MIM:615002\|HGNC:HGNC:1470\|Ensembl:ENSG00000110931\|HPRD:06467\|Vega:OTTHUMG00000169156
Gene type	protein-coding
Map location	12q24.2
Pascal p-value	0.02
Sherlock p-value	0.681
DEG p-value	DEG:Maycox_2009:CC_BA10_fold_change=-1.16:CC_BA10_disease_P=0.0165:HBB_BA9_fold_change=-1.49:HBB_BA9_disease_P=0.0230
Fetal beta	-1.531
DMG	1 (# studies)
eGene	Myers' cis & trans Meta
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Maycox_2009	Microarray to determine the expression of over 30000 mRNA transcripts in post-mortem tissue	We included 51 genes whose expression changes are common between two schizophrenia cohorts.
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13839391	12	121719066	CAMKK2	1.052E-4	0.351	0.028	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs208296	chr12	121600952	CAMKK2	10645	0.13	cis
rs2071272	chr12	121670791	CAMKK2	10645	0.01	cis
rs2252304	chr12	121673599	CAMKK2	10645	0.05	cis
rs2567982	chr12	121675713	CAMKK2	10645	0	cis
rs1063843	chr12	121681686	CAMKK2	10645	0.18	cis
rs2288693	chr12	121687473	CAMKK2	10645	0.02	cis
rs2079965	chr7	71227723	CAMKK2	10645	0.14	trans
rs2567982	chr12	121675713	CAMKK2	10645	0.16	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005509	calcium ion binding	IDA		11395482
GO:0005516	calmodulin binding	TAS		11395482
GO:0005524	ATP binding	IEA		-
GO:0004683	calmodulin-dependent protein kinase activity	IEA		-
GO:0004713	protein tyrosine kinase activity	TAS		11395482
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000165	MAPKKK cascade	TAS		11395482
GO:0019722	calcium-mediated signaling	TAS		11395482
GO:0045941	positive regulation of transcription	TAS		11395482
GO:0045859	regulation of protein kinase activity	TAS		11395482
GO:0046777	protein amino acid autophosphorylation	IDA		11395482
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	TAS		11395482
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ADIPOCYTOKINE SIGNALING PATHWAY	67	57	All SZGR 2.0 genes in this pathway
BIOCARTA CACAM PATHWAY	16	11	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
LIU PROSTATE CANCER UP	96	57	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO ANDROGEN UP	29	21	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO FORSKOLIN UP	23	17	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN	126	86	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
LUCAS HNF4A TARGETS UP	58	36	All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS AND SERUM RESPONSE UP	47	32	All SZGR 2.0 genes in this pathway
TOMLINS PROSTATE CANCER UP	40	27	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
FALVELLA SMOKERS WITH LUNG CANCER	80	52	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A DN	103	71	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
STARK HYPPOCAMPUS 22Q11 DELETION UP	53	40	All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION L1 G1 DN	12	6	All SZGR 2.0 genes in this pathway
NELSON RESPONSE TO ANDROGEN UP	86	61	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT DN	165	106	All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1	419	273	All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE	246	153	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
FIRESTEIN CTNNB1 PATHWAY	33	23	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA D CLUSTER DN	40	26	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED	536	296	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3 UNMETHYLATED	37	21	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED	228	119	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-153	2849	2855	m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-25/32/92/363/367	1853	1859	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-29	2717	2723	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-30-5p	1987	1994	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-329	98	104	1A	hsa-miR-329^brain	AACACACCUGGUUAACCUCUUU
miR-342	226	232	m8	hsa-miR-342^brain	UCUCACACAGAAAUCGCACCCGUC
miR-378	597	604	1A,m8	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-9	2153	2160	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CAMKK2