SZGR2

Summary ?

GeneID	10875
Symbol	FGL2
Synonyms	T49\|pT49
Description	fibrinogen like 2
Reference	MIM:605351\|HGNC:HGNC:3696\|Ensembl:ENSG00000127951\|HPRD:16098\|Vega:OTTHUMG00000130681
Gene type	protein-coding
Map location	7q11.23
Pascal p-value	0.015
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs17131472	chr1	91962966	FGL2	10875	1.493E-5	trans
rs546975	chr1	91963738	FGL2	10875	0.04	trans
snp_a-2062139		0	FGL2	10875	0.14	trans
rs10218671	chr1	158362552	FGL2	10875	0.15	trans
rs17021120	chr2	37843018	FGL2	10875	0.09	trans
rs17021123	chr2	37843420	FGL2	10875	0.09	trans
rs17021127	chr2	37843523	FGL2	10875	0.06	trans
rs17821815	chr2	119018522	FGL2	10875	0.13	trans
rs2115055	chr2	119478688	FGL2	10875	0.05	trans
rs2922180	chr3	125280472	FGL2	10875	1.152E-5	trans
rs2971271	chr3	125450402	FGL2	10875	0.01	trans
rs2976809	chr3	125451738	FGL2	10875	3.821E-8	trans
rs9917710	chr3	176280218	FGL2	10875	0.2	trans
rs6437445	chr3	194694054	FGL2	10875	0.13	trans
rs16889842	chr4	9872012	FGL2	10875	0.01	trans
snp_a-1976228		0	FGL2	10875	0.04	trans
rs17090446	chr4	62255221	FGL2	10875	0.04	trans
rs7668550	chr4	104384355	FGL2	10875	0.07	trans
rs3796892	chr4	111404774	FGL2	10875	0.01	trans
rs4033102	chr4	111784204	FGL2	10875	0.01	trans
rs509952	chr4	111788169	FGL2	10875	0.01	trans
rs313946	chr4	113975904	FGL2	10875	0	trans
rs657141	chr4	113981041	FGL2	10875	0.13	trans
rs10065849	chr5	30592364	FGL2	10875	0.13	trans
rs10050805	chr5	30805352	FGL2	10875	5.68E-5	trans
rs837115	chr5	40736290	FGL2	10875	0.05	trans
rs6449550	chr5	61034312	FGL2	10875	0.04	trans
rs6874540	chr5	149911669	FGL2	10875	0.02	trans
rs2273232	chr5	149912526	FGL2	10875	0.02	trans
rs17056435	chr5	158453782	FGL2	10875	1.814E-5	trans
rs9313797	chr5	158465457	FGL2	10875	0.15	trans
rs17056474	chr5	158468105	FGL2	10875	0.15	trans
rs17135501	chr6	2704474	FGL2	10875	0	trans
rs17135521	chr6	2707631	FGL2	10875	0	trans
snp_a-1787926		0	FGL2	10875	0	trans
rs6455226	chr6	67930295	FGL2	10875	0.01	trans
rs2064428	chr6	85067126	FGL2	10875	0.03	trans
rs9451867	chr6	92659609	FGL2	10875	0.06	trans
rs283058	chr6	118625224	FGL2	10875	0.17	trans
rs8192621	chr6	132966206	FGL2	10875	0.2	trans
rs2056744	chr6	144952933	FGL2	10875	0.03	trans
rs17073995	chr6	144958809	FGL2	10875	0.12	trans
rs2398707	chr7	2113428	FGL2	10875	0.18	trans
rs3778951	chr7	2125319	FGL2	10875	0.18	trans
rs3778957	chr7	2127710	FGL2	10875	0.18	trans
rs2286089	chr7	38789903	FGL2	10875	0.12	trans
rs10085487	chr7	38870379	FGL2	10875	0.13	trans
rs17165913	chr7	93555935	FGL2	10875	0.17	trans
rs2430483	chr7	104548631	FGL2	10875	0.02	trans
rs2515591	chr8	6335547	FGL2	10875	0.1	trans
rs2515434	chr8	6374892	FGL2	10875	0.15	trans
rs2442623	chr8	6376337	FGL2	10875	0.15	trans
rs2515437	chr8	6377140	FGL2	10875	0.15	trans
rs1960369	chr8	6379235	FGL2	10875	0.08	trans
rs2199402	chr8	9201002	FGL2	10875	0.06	trans
rs7841407	chr8	9243427	FGL2	10875	0.02	trans
rs2739726	chr8	17998576	FGL2	10875	0.03	trans
rs3808368	chr8	32503075	FGL2	10875	0.09	trans
rs2954041	chr8	32522625	FGL2	10875	0.01	trans
rs2919377	chr8	32573740	FGL2	10875	0.02	trans
rs2976526	chr8	32574650	FGL2	10875	0.01	trans
rs2975504	chr8	32578998	FGL2	10875	0.01	trans
rs16929407	chr8	63602017	FGL2	10875	0.12	trans
rs16929409	chr8	63603088	FGL2	10875	0.09	trans
rs16929424	chr8	63608389	FGL2	10875	0.06	trans
rs16908622	chr8	139231604	FGL2	10875	0.13	trans
rs7850851	chr9	37928770	FGL2	10875	0.02	trans
rs10521469	chr9	78884328	FGL2	10875	0.18	trans
rs2253777	chr9	93467893	FGL2	10875	0.04	trans
rs427497	chr9	107982791	FGL2	10875	0.14	trans
rs6478086	chr9	117273020	FGL2	10875	0.17	trans
rs998410	chr9	117622673	FGL2	10875	0	trans
rs9423711	chr10	2574802	FGL2	10875	0	trans
rs748375	chr10	33440178	FGL2	10875	0.04	trans
rs4514358	chr10	43861923	FGL2	10875	4.149E-4	trans
rs7081666	chr10	47673800	FGL2	10875	0.01	trans
rs2116478	chr11	83362424	FGL2	10875	0.05	trans
rs2305164	chr12	365649	FGL2	10875	0	trans
rs2098090	chr12	4770747	FGL2	10875	0.03	trans
rs10747972		0	FGL2	10875	0.12	trans
rs995817	chr12	67557935	FGL2	10875	0.01	trans
rs10879027	chr12	70237156	FGL2	10875	6.184E-4	trans
rs11179317	chr12	73069562	FGL2	10875	0.07	trans
rs11112163	chr12	105072508	FGL2	10875	0.01	trans
rs11067174	chr12	115011927	FGL2	10875	0.02	trans
rs17080889	chr13	20939135	FGL2	10875	0.03	trans
rs9552848	chr13	23705933	FGL2	10875	0.13	trans
rs9551590	chr13	29589464	FGL2	10875	0.01	trans
rs1750009	chr13	42657093	FGL2	10875	0.05	trans
rs7982922	chr13	43873335	FGL2	10875	0.19	trans
rs9596788	chr13	53924430	FGL2	10875	0.11	trans
rs9529974	chr13	72821935	FGL2	10875	0.01	trans
rs17073665	chr13	81541961	FGL2	10875	0	trans
rs11840833	chr13	94378306	FGL2	10875	1.552E-4	trans
rs9302031	chr13	95633204	FGL2	10875	0.16	trans
rs17381373	chr13	109002943	FGL2	10875	0.13	trans
rs16975617	chr13	110867407	FGL2	10875	0.17	trans
rs10142086	chr14	35135892	FGL2	10875	0.07	trans
rs1956517	chr14	37738426	FGL2	10875	0.01	trans
rs10498433	chr14	52289530	FGL2	10875	0.11	trans
rs1951867	chr14	54407191	FGL2	10875	0.1	trans
rs2093759	chr14	97171024	FGL2	10875	0	trans
rs17244419	chr14	97171074	FGL2	10875	1.708E-4	trans
rs7177212	chr15	34425413	FGL2	10875	0.09	trans
rs16976022	chr15	55454260	FGL2	10875	0.08	trans
rs16976029	chr15	55455268	FGL2	10875	0.06	trans
rs16976036	chr15	55456921	FGL2	10875	0.16	trans
rs7165622	chr15	93979910	FGL2	10875	0.05	trans
rs13380712	chr16	25601181	FGL2	10875	0.01	trans
rs17841422	chr17	20969134	FGL2	10875	0.01	trans
rs8079075	chr17	38010814	FGL2	10875	0.06	trans
rs16977927	chr17	72154232	FGL2	10875	0.06	trans
rs16940550	chr18	13442256	FGL2	10875	0.05	trans
rs7236407	chr18	47827597	FGL2	10875	0.03	trans
rs11873703	chr18	61448702	FGL2	10875	1.213E-6	trans
rs6017989	chr20	45329846	FGL2	10875	0.11	trans
rs6095741	chr20	48666589	FGL2	10875	2.455E-9	trans
rs6004906	chr22	26434554	FGL2	10875	0.08	trans
rs6000401	chr22	37149335	FGL2	10875	0.05	trans
rs5768165	chr22	48318197	FGL2	10875	0.2	trans
rs5768168	chr22	48319334	FGL2	10875	0.2	trans
rs5768173	chr22	48321475	FGL2	10875	0.2	trans
rs1883665	chrX	17650382	FGL2	10875	0.1	trans
rs5991662	chrX	43335796	FGL2	10875	0	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RUNDC3A	0.92	0.92
FKBP8	0.90	0.90
ST6GALNAC6	0.89	0.90
PTGES2	0.89	0.90
HAGH	0.89	0.91
NBL1	0.87	0.89
TUBG2	0.87	0.88
GNG3	0.86	0.88
HMOX2	0.86	0.87
SH3GLB2	0.86	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
THOC2	-0.57	-0.52
ZNF300	-0.57	-0.31
ATAD2B	-0.56	-0.47
BAZ1A	-0.56	-0.76
IGF2BP2	-0.56	-0.53
EZH2	-0.56	-0.50
IGF2BP3	-0.55	-0.43
ZNF345	-0.55	-0.43
UPF3B	-0.55	-0.53
NASP	-0.55	-0.45

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IEA	Neurotransmitter (GO term level: 4)	-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007165	signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005577	fibrinogen complex	TAS		7642106

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
PIEPOLI LGI1 TARGETS UP	15	11	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN	116	79	All SZGR 2.0 genes in this pathway
LIU TARGETS OF VMYB VS CMYB UP	20	12	All SZGR 2.0 genes in this pathway
GAL LEUKEMIC STEM CELL DN	244	153	All SZGR 2.0 genes in this pathway
WIKMAN ASBESTOS LUNG CANCER DN	28	13	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D UP	175	108	All SZGR 2.0 genes in this pathway
BILBAN B CLL LPL DN	42	25	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN	54	38	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN	232	154	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 DN	229	142	All SZGR 2.0 genes in this pathway
MAHADEVAN IMATINIB RESISTANCE DN	20	11	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
BORLAK LIVER CANCER EGF UP	57	41	All SZGR 2.0 genes in this pathway
WATTEL AUTONOMOUS THYROID ADENOMA DN	55	29	All SZGR 2.0 genes in this pathway
LE EGR2 TARGETS DN	108	84	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS B LYMPHOCYTE UP	78	51	All SZGR 2.0 genes in this pathway
WIELAND UP BY HBV INFECTION	101	66	All SZGR 2.0 genes in this pathway
LU IL4 SIGNALING	94	56	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
FAELT B CLL WITH VH REARRANGEMENTS UP	48	34	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
LENAOUR DENDRITIC CELL MATURATION DN	128	90	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 2	72	52	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 8HR	39	31	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES UP	253	147	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3	160	103	All SZGR 2.0 genes in this pathway
GAVIN PDE3B TARGETS	22	15	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED	1022	619	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE UP	156	92	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP	299	167	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D DN	252	155	All SZGR 2.0 genes in this pathway
WU SILENCED BY METHYLATION IN BLADDER CANCER	55	42	All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE	346	192	All SZGR 2.0 genes in this pathway
ICHIBA GRAFT VERSUS HOST DISEASE D7 UP	107	67	All SZGR 2.0 genes in this pathway
ICHIBA GRAFT VERSUS HOST DISEASE 35D UP	131	79	All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION D	68	44	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE DN	50	33	All SZGR 2.0 genes in this pathway
ZHAN VARIABLE EARLY DIFFERENTIATION GENES UP	15	9	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE UP	62	42	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 ICP WITH H3K27ME3	74	46	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3	126	83	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA1 UP	101	66	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1	237	159	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3	137	85	All SZGR 2.0 genes in this pathway
NIELSEN GIST VS SYNOVIAL SARCOMA DN	20	17	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS DN	148	88	All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP	364	236	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway
RATTENBACHER BOUND BY CELF1	467	251	All SZGR 2.0 genes in this pathway
ALTEMEIER RESPONSE TO LPS WITH MECHANICAL VENTILATION	128	81	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP	489	314	All SZGR 2.0 genes in this pathway
NABA ECM GLYCOPROTEINS	196	99	All SZGR 2.0 genes in this pathway
NABA CORE MATRISOME	275	148	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	2373	2380	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FGL2