Gene Page: TLK2
Summary ?
GeneID | 11011 |
Symbol | TLK2 |
Synonyms | HsHPK|PKU-ALPHA |
Description | tousled like kinase 2 |
Reference | MIM:608439|HGNC:HGNC:11842|HPRD:10527| |
Gene type | protein-coding |
Map location | 17q23 |
Pascal p-value | 0.044 |
Sherlock p-value | 0.907 |
TADA p-value | 0.013 |
Fetal beta | 0.509 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Gulsuner_2013 | Whole Exome Sequencing analysis | 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents. | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0673 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
TLK2 | chr17 | 60642438 | G | A | NM_001112707 NM_006852 | p.271R>Q p.303R>Q | missense missense | Schizophrenia | DNM:Gulsuner_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ALDH1L1 | 0.91 | 0.90 |
METTL7A | 0.86 | 0.90 |
MERTK | 0.86 | 0.90 |
RANBP3L | 0.85 | 0.88 |
ALDH6A1 | 0.85 | 0.89 |
MRO | 0.85 | 0.87 |
HTRA1 | 0.85 | 0.91 |
NDRG2 | 0.84 | 0.88 |
ALDH2 | 0.84 | 0.84 |
CYP4F11 | 0.84 | 0.85 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PHF14 | -0.58 | -0.70 |
MLLT11 | -0.57 | -0.65 |
PPP3CC | -0.57 | -0.68 |
DPF1 | -0.57 | -0.65 |
MED19 | -0.57 | -0.70 |
RNF19B | -0.57 | -0.67 |
FAM40A | -0.57 | -0.63 |
STMN2 | -0.57 | -0.68 |
MPP3 | -0.56 | -0.64 |
RTF1 | -0.56 | -0.65 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005515 | protein binding | IPI | 17353931 | |
GO:0005524 | ATP binding | IDA | 12660173 | |
GO:0004674 | protein serine/threonine kinase activity | IDA | 12660173 | |
GO:0004674 | protein serine/threonine kinase activity | NAS | 9427565 |10523312 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001672 | regulation of chromatin assembly or disassembly | IDA | 12660173 | |
GO:0006468 | protein amino acid phosphorylation | IDA | 12660173 | |
GO:0007242 | intracellular signaling cascade | IDA | 12660173 | |
GO:0007049 | cell cycle | IEA | - | |
GO:0006974 | response to DNA damage stimulus | IEA | - | |
GO:0016568 | chromatin modification | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 9427565 | |
GO:0005634 | nucleus | NAS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS UP | 214 | 134 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
HEIDENBLAD AMPLIFIED IN PANCREATIC CANCER | 31 | 19 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON | 335 | 181 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
PARK HSC MARKERS | 44 | 31 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D5 | 39 | 26 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
CHENG RESPONSE TO NICKEL ACETATE | 45 | 29 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
WENDT COHESIN TARGETS UP | 33 | 19 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS UP | 295 | 155 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 300 | 306 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-125/351 | 326 | 332 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-128 | 302 | 308 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-217 | 921 | 927 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-218 | 463 | 469 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-22 | 185 | 191 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-26 | 369 | 375 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-27 | 302 | 309 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-320 | 681 | 687 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-384 | 206 | 212 | 1A | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.