SZGR2

Summary ?

GeneID	11011
Symbol	TLK2
Synonyms	HsHPK\|PKU-ALPHA
Description	tousled like kinase 2
Reference	MIM:608439\|HGNC:HGNC:11842\|HPRD:10527\|
Gene type	protein-coding
Map location	17q23
Pascal p-value	0.044
Sherlock p-value	0.907
TADA p-value	0.013
Fetal beta	0.509

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Gulsuner_2013	Whole Exome Sequencing analysis	155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents.
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0673

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
TLK2	chr17	60642438	G	A	NM_001112707 NM_006852	p.271R>Q p.303R>Q	missense missense			Schizophrenia	DNM:Gulsuner_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ALDH1L1	0.91	0.90
METTL7A	0.86	0.90
MERTK	0.86	0.90
RANBP3L	0.85	0.88
ALDH6A1	0.85	0.89
MRO	0.85	0.87
HTRA1	0.85	0.91
NDRG2	0.84	0.88
ALDH2	0.84	0.84
CYP4F11	0.84	0.85

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PHF14	-0.58	-0.70
MLLT11	-0.57	-0.65
PPP3CC	-0.57	-0.68
DPF1	-0.57	-0.65
MED19	-0.57	-0.70
RNF19B	-0.57	-0.67
FAM40A	-0.57	-0.63
STMN2	-0.57	-0.68
MPP3	-0.56	-0.64
RTF1	-0.56	-0.65

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0005515	protein binding	IPI		17353931
GO:0005524	ATP binding	IDA		12660173
GO:0004674	protein serine/threonine kinase activity	IDA		12660173
GO:0004674	protein serine/threonine kinase activity	NAS		9427565 \|10523312
GO:0016740	transferase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001672	regulation of chromatin assembly or disassembly	IDA		12660173
GO:0006468	protein amino acid phosphorylation	IDA		12660173
GO:0007242	intracellular signaling cascade	IDA		12660173
GO:0007049	cell cycle	IEA		-
GO:0006974	response to DNA damage stimulus	IEA		-
GO:0016568	chromatin modification	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		9427565
GO:0005634	nucleus	NAS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DAVICIONI MOLECULAR ARMS VS ERMS UP	332	228	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP	214	134	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLIFIED IN PANCREATIC CANCER	31	19	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON	335	181	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
PARK HSC MARKERS	44	31	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN	123	86	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D5	39	26	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
CHENG RESPONSE TO NICKEL ACETATE	45	29	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
WENDT COHESIN TARGETS UP	33	19	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
WOO LIVER CANCER RECURRENCE UP	105	75	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS UP	295	155	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	300	306	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-125/351	326	332	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	326	332	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-128	302	308	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	302	308	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-217	921	927	m8	hsa-miR-217	UACUGCAUCAGGAACUGAUUGGAU
miR-218	463	469	1A	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-22	185	191	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-26	369	375	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	369	375	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-27	302	309	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	302	309	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-320	681	687	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-384	206	212	1A	hsa-miR-384	AUUCCUAGAAAUUGUUCAUA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TLK2