Gene Page: STMN2
Summary ?
| GeneID | 11075 |
| Symbol | STMN2 |
| Synonyms | SCG10|SCGN10 |
| Description | stathmin 2 |
| Reference | MIM:600621|HGNC:HGNC:10577|Ensembl:ENSG00000104435|HPRD:09003|Vega:OTTHUMG00000164610 |
| Gene type | protein-coding |
| Map location | 8q21.13 |
| Pascal p-value | 0.065 |
| Sherlock p-value | 0.906 |
| Fetal beta | 0.336 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs12123144 | chr1 | 76550208 | STMN2 | 11075 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MRPS22 | 0.88 | 0.87 |
| COMMD8 | 0.87 | 0.87 |
| RP4-604K5.1 | 0.87 | 0.85 |
| CCDC104 | 0.86 | 0.85 |
| ATP5F1 | 0.85 | 0.81 |
| COMMD10 | 0.85 | 0.84 |
| CHMP5 | 0.84 | 0.80 |
| COPS4 | 0.84 | 0.84 |
| PSMC6 | 0.84 | 0.83 |
| TXNDC9 | 0.83 | 0.82 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TENC1 | -0.48 | -0.53 |
| MTSS1L | -0.48 | -0.51 |
| MICALL2 | -0.46 | -0.51 |
| FAM38A | -0.46 | -0.47 |
| DOCK6 | -0.46 | -0.47 |
| AF347015.18 | -0.45 | -0.29 |
| C10orf108 | -0.45 | -0.51 |
| AC020763.2 | -0.44 | -0.48 |
| C9orf131 | -0.44 | -0.50 |
| AC010618.2 | -0.44 | -0.50 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 16189514 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0030182 | neuron differentiation | NAS | neuron (GO term level: 8) | - |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0042995 | cell projection | IEA | axon (GO term level: 4) | - |
| GO:0030426 | growth cone | IEA | axon, dendrite (GO term level: 5) | - |
| GO:0005624 | membrane fraction | NAS | - | |
| GO:0005625 | soluble fraction | NAS | - | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
| LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 CHRONIC LOF UP | 115 | 78 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| COWLING MYCN TARGETS | 43 | 27 | All SZGR 2.0 genes in this pathway |
| ROPERO HDAC2 TARGETS | 114 | 71 | All SZGR 2.0 genes in this pathway |
| BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 8Q12 Q22 AMPLICON | 132 | 82 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 16HR DN | 86 | 62 | All SZGR 2.0 genes in this pathway |
| MCCLUNG DELTA FOSB TARGETS 2WK | 48 | 36 | All SZGR 2.0 genes in this pathway |
| MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
| XU GH1 AUTOCRINE TARGETS UP | 268 | 157 | All SZGR 2.0 genes in this pathway |
| HANN RESISTANCE TO BCL2 INHIBITOR UP | 36 | 24 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
| WINNEPENNINCKX MELANOMA METASTASIS DN | 46 | 26 | All SZGR 2.0 genes in this pathway |
| GYORFFY DOXORUBICIN RESISTANCE | 56 | 34 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| DASU IL6 SIGNALING UP | 59 | 44 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
| PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
| SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR DN | 244 | 157 | All SZGR 2.0 genes in this pathway |
| DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-34b | 43 | 49 | 1A | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
| miR-369-3p | 50 | 56 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-374 | 50 | 57 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-485-3p | 85 | 91 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.