Gene Page: COL8A1
Summary ?
| GeneID | 1295 |
| Symbol | COL8A1 |
| Synonyms | C3orf7 |
| Description | collagen type VIII alpha 1 |
| Reference | MIM:120251|HGNC:HGNC:2215|Ensembl:ENSG00000144810|HPRD:00372| |
| Gene type | protein-coding |
| Map location | 3q12.3 |
| Pascal p-value | 0.048 |
| Fetal beta | -0.405 |
| eGene | Putamen basal ganglia Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.04047 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04359 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10994209 | chr10 | 61877705 | COL8A1 | 1295 | 0.01 | trans | ||
| rs6440606 | 3 | 99153006 | COL8A1 | ENSG00000144810.11 | 3.573E-6 | 0.01 | -204313 | gtex_brain_putamen_basal |
| rs4402963 | 3 | 99153543 | COL8A1 | ENSG00000144810.11 | 5.752E-6 | 0.01 | -203776 | gtex_brain_putamen_basal |
| rs4532167 | 3 | 99156492 | COL8A1 | ENSG00000144810.11 | 3.075E-6 | 0.01 | -200827 | gtex_brain_putamen_basal |
| rs2880364 | 3 | 99156869 | COL8A1 | ENSG00000144810.11 | 1.426E-6 | 0.01 | -200450 | gtex_brain_putamen_basal |
| rs2700666 | 3 | 99157048 | COL8A1 | ENSG00000144810.11 | 2.877E-6 | 0.01 | -200271 | gtex_brain_putamen_basal |
| rs2464149 | 3 | 99157687 | COL8A1 | ENSG00000144810.11 | 2.687E-6 | 0.01 | -199632 | gtex_brain_putamen_basal |
| rs2700656 | 3 | 99157832 | COL8A1 | ENSG00000144810.11 | 2.687E-6 | 0.01 | -199487 | gtex_brain_putamen_basal |
| rs2700650 | 3 | 99158618 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -198701 | gtex_brain_putamen_basal |
| rs2700645 | 3 | 99159460 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -197859 | gtex_brain_putamen_basal |
| rs2700633 | 3 | 99160551 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -196768 | gtex_brain_putamen_basal |
| rs2700632 | 3 | 99160577 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -196742 | gtex_brain_putamen_basal |
| rs2670331 | 3 | 99160633 | COL8A1 | ENSG00000144810.11 | 2.744E-6 | 0.01 | -196686 | gtex_brain_putamen_basal |
| rs2670332 | 3 | 99160639 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -196680 | gtex_brain_putamen_basal |
| rs2670335 | 3 | 99161297 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -196022 | gtex_brain_putamen_basal |
| rs2458516 | 3 | 99161582 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -195737 | gtex_brain_putamen_basal |
| rs2670338 | 3 | 99162536 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -194783 | gtex_brain_putamen_basal |
| rs2670340 | 3 | 99162713 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -194606 | gtex_brain_putamen_basal |
| rs2670342 | 3 | 99163190 | COL8A1 | ENSG00000144810.11 | 2.67E-6 | 0.01 | -194129 | gtex_brain_putamen_basal |
| rs2670343 | 3 | 99163341 | COL8A1 | ENSG00000144810.11 | 3.101E-6 | 0.01 | -193978 | gtex_brain_putamen_basal |
| rs2670344 | 3 | 99163610 | COL8A1 | ENSG00000144810.11 | 6.645E-6 | 0.01 | -193709 | gtex_brain_putamen_basal |
| rs2700617 | 3 | 99163611 | COL8A1 | ENSG00000144810.11 | 6.618E-6 | 0.01 | -193708 | gtex_brain_putamen_basal |
| rs2670345 | 3 | 99163774 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -193545 | gtex_brain_putamen_basal |
| rs2670346 | 3 | 99163961 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -193358 | gtex_brain_putamen_basal |
| rs2262623 | 3 | 99164806 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -192513 | gtex_brain_putamen_basal |
| rs2464147 | 3 | 99165484 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -191835 | gtex_brain_putamen_basal |
| rs2951498 | 3 | 99166060 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -191259 | gtex_brain_putamen_basal |
| rs2951497 | 3 | 99166634 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -190685 | gtex_brain_putamen_basal |
| rs2670321 | 3 | 99167107 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -190212 | gtex_brain_putamen_basal |
| rs2670322 | 3 | 99167401 | COL8A1 | ENSG00000144810.11 | 2.6E-6 | 0.01 | -189918 | gtex_brain_putamen_basal |
| rs2700652 | 3 | 99168238 | COL8A1 | ENSG00000144810.11 | 2.678E-6 | 0.01 | -189081 | gtex_brain_putamen_basal |
| rs2670323 | 3 | 99168893 | COL8A1 | ENSG00000144810.11 | 2.678E-6 | 0.01 | -188426 | gtex_brain_putamen_basal |
| rs2670325 | 3 | 99169461 | COL8A1 | ENSG00000144810.11 | 3.483E-6 | 0.01 | -187858 | gtex_brain_putamen_basal |
| rs2942828 | 3 | 99169691 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -187628 | gtex_brain_putamen_basal |
| rs2670326 | 3 | 99169854 | COL8A1 | ENSG00000144810.11 | 2.464E-6 | 0.01 | -187465 | gtex_brain_putamen_basal |
| rs2700653 | 3 | 99169966 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -187353 | gtex_brain_putamen_basal |
| rs2700654 | 3 | 99169981 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -187338 | gtex_brain_putamen_basal |
| rs2700655 | 3 | 99170697 | COL8A1 | ENSG00000144810.11 | 5.168E-6 | 0.01 | -186622 | gtex_brain_putamen_basal |
| rs2458515 | 3 | 99171844 | COL8A1 | ENSG00000144810.11 | 3.216E-6 | 0.01 | -185475 | gtex_brain_putamen_basal |
| rs7614897 | 3 | 99173177 | COL8A1 | ENSG00000144810.11 | 4.084E-6 | 0.01 | -184142 | gtex_brain_putamen_basal |
| rs7427502 | 3 | 99174171 | COL8A1 | ENSG00000144810.11 | 2.564E-6 | 0.01 | -183148 | gtex_brain_putamen_basal |
| rs2700662 | 3 | 99175428 | COL8A1 | ENSG00000144810.11 | 2.678E-6 | 0.01 | -181891 | gtex_brain_putamen_basal |
| rs34745711 | 3 | 99177642 | COL8A1 | ENSG00000144810.11 | 2.678E-6 | 0.01 | -179677 | gtex_brain_putamen_basal |
| rs2670330 | 3 | 99178087 | COL8A1 | ENSG00000144810.11 | 2.682E-6 | 0.01 | -179232 | gtex_brain_putamen_basal |
| rs2700657 | 3 | 99178245 | COL8A1 | ENSG00000144810.11 | 2.58E-6 | 0.01 | -179074 | gtex_brain_putamen_basal |
| rs2246151 | 3 | 99179308 | COL8A1 | ENSG00000144810.11 | 2.678E-6 | 0.01 | -178011 | gtex_brain_putamen_basal |
| rs2246020 | 3 | 99180244 | COL8A1 | ENSG00000144810.11 | 7.601E-7 | 0.01 | -177075 | gtex_brain_putamen_basal |
| rs2670329 | 3 | 99182357 | COL8A1 | ENSG00000144810.11 | 2.587E-6 | 0.01 | -174962 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0005198 | structural molecule activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007155 | cell adhesion | IEA | - | |
| GO:0050673 | epithelial cell proliferation | IEA | - | |
| GO:0048593 | camera-type eye morphogenesis | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005591 | collagen type VIII | TAS | 2029894 | |
| GO:0005604 | basement membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
| PID SYNDECAN 1 PATHWAY | 46 | 29 | All SZGR 2.0 genes in this pathway |
| REACTOME EXTRACELLULAR MATRIX ORGANIZATION | 87 | 42 | All SZGR 2.0 genes in this pathway |
| REACTOME COLLAGEN FORMATION | 58 | 31 | All SZGR 2.0 genes in this pathway |
| BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA UP | 294 | 178 | All SZGR 2.0 genes in this pathway |
| TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL UP | 69 | 38 | All SZGR 2.0 genes in this pathway |
| TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL DN | 74 | 42 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| WAMUNYOKOLI OVARIAN CANCER LMP DN | 199 | 124 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| BARIS THYROID CANCER DN | 59 | 45 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 3 4WK UP | 214 | 144 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
| SEITZ NEOPLASTIC TRANSFORMATION BY 8P DELETION DN | 30 | 25 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 12HR DN | 57 | 45 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
| KANG IMMORTALIZED BY TERT UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
| PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
| MACLACHLAN BRCA1 TARGETS DN | 16 | 12 | All SZGR 2.0 genes in this pathway |
| SIMBULAN PARP1 TARGETS UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA DELAYED RESPONSE TO TGFB1 | 39 | 26 | All SZGR 2.0 genes in this pathway |
| MCCLUNG COCAIN REWARD 4WK | 75 | 47 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS PEAK AT 0HR | 63 | 48 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
| LEIN CHOROID PLEXUS MARKERS | 103 | 61 | All SZGR 2.0 genes in this pathway |
| KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
| YAGUE PRETUMOR DRUG RESISTANCE DN | 13 | 11 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS HCP WITH H3 UNMETHYLATED | 80 | 50 | All SZGR 2.0 genes in this pathway |
| NAKAYAMA FGF2 TARGETS | 29 | 17 | All SZGR 2.0 genes in this pathway |
| NAKAMURA ADIPOGENESIS EARLY UP | 66 | 44 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA RESPONSE TO TGFB1 C6 | 5 | 5 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR DN | 88 | 59 | All SZGR 2.0 genes in this pathway |
| MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
| NABA COLLAGENS | 44 | 26 | All SZGR 2.0 genes in this pathway |
| NABA CORE MATRISOME | 275 | 148 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-493-5p | 143 | 149 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.