SZGR2

Summary ?

GeneID	152404
Symbol	IGSF11
Synonyms	BT-IgSF\|CT119\|CXADRL1\|Igsf13\|VSIG3
Description	immunoglobulin superfamily member 11
Reference	MIM:608351\|HGNC:HGNC:16669\|Ensembl:ENSG00000144847\|HPRD:16321\|Vega:OTTHUMG00000159387
Gene type	protein-coding
Map location	3q13.32
Pascal p-value	0.301
DEG p-value	DEG:Zhao_2015:p=2.33e-04:q=0.0862
Fetal beta	-0.609
DMG	1 (# studies)
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Zhao_2015	RNA Sequencing analysis	Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.04047
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04359

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06491249	3	118754097	IGSF11	5.19E-5	0.716	0.022	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001558	regulation of cell growth	IEA		-
GO:0007155	cell adhesion	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KIM MYC AMPLIFICATION TARGETS UP	201	127	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER B	48	22	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K9ME3 UP	141	75	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-181	1743	1749	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-186	1844	1850	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-186	1844	1850	m8	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-339	1537	1543	1A	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: IGSF11