Gene Page: MBOAT1
Summary ?
| GeneID | 154141 |
| Symbol | MBOAT1 |
| Synonyms | LPEAT1|LPLAT|LPLAT 1|LPSAT|OACT1|dJ434O11.1 |
| Description | membrane bound O-acyltransferase domain containing 1 |
| Reference | MIM:611732|HGNC:HGNC:21579| |
| Gene type | protein-coding |
| Map location | 6p22.3 |
| Pascal p-value | 0.043 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| Expression | Meta-analysis of gene expression | P value: 1.907 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008415 | acyltransferase activity | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCEROLIPID METABOLISM | 49 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG GLYCEROPHOSPHOLIPID METABOLISM | 77 | 35 | All SZGR 2.0 genes in this pathway |
| REACTOME PHOSPHOLIPID METABOLISM | 198 | 112 | All SZGR 2.0 genes in this pathway |
| REACTOME ACYL CHAIN REMODELLING OF PE | 21 | 13 | All SZGR 2.0 genes in this pathway |
| REACTOME ACYL CHAIN REMODELLING OF PS | 15 | 7 | All SZGR 2.0 genes in this pathway |
| REACTOME GLYCEROPHOSPHOLIPID BIOSYNTHESIS | 82 | 39 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL BREAST 5 6WK UP | 116 | 68 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 6P24 P22 AMPLICON | 21 | 17 | All SZGR 2.0 genes in this pathway |
| BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
| DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS | 212 | 121 | All SZGR 2.0 genes in this pathway |
| CHANG CYCLING GENES | 148 | 83 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| WHITFIELD CELL CYCLE G1 S | 147 | 76 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 6HR UP | 229 | 149 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| FOSTER KDM1A TARGETS UP | 266 | 142 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY LUMINAL MATURE UP | 116 | 65 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-181 | 1354 | 1360 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-24 | 957 | 964 | 1A,m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
| miR-30-5p | 94 | 101 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.