SZGR2

Summary ?

GeneID	176
Symbol	ACAN
Synonyms	AGC1\|AGCAN\|CSPG1\|CSPGCP\|MSK16\|SEDK
Description	aggrecan
Reference	MIM:155760\|HGNC:HGNC:319\|Ensembl:ENSG00000157766\|HPRD:01123\|Vega:OTTHUMG00000171989
Gene type	protein-coding
Map location	15q26.1
Pascal p-value	0.009
Support	G2Cdb.human_mGluR5

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005529	sugar binding	IEA		-
GO:0005540	hyaluronic acid binding	ISS		1569188
GO:0005515	protein binding	IEA		-
GO:0030021	extracellular matrix structural constituent conferring compression resistance	ISS		1569188
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001501	skeletal system development	NAS		1569188
GO:0001502	cartilage condensation	IEA		-
GO:0007155	cell adhesion	IEA		-
GO:0006508	proteolysis	NAS		1569188
GO:0030166	proteoglycan biosynthetic process	IEA		-
GO:0030199	collagen fibril organization	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005604	basement membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME KERATAN SULFATE BIOSYNTHESIS	26	18	All SZGR 2.0 genes in this pathway
REACTOME KERATAN SULFATE KERATIN METABOLISM	30	21	All SZGR 2.0 genes in this pathway
REACTOME KERATAN SULFATE DEGRADATION	11	7	All SZGR 2.0 genes in this pathway
REACTOME GLYCOSAMINOGLYCAN METABOLISM	111	69	All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF CARBOHYDRATES	247	154	All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA DN	62	41	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER UP	142	96	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP	162	104	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP	147	101	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP	146	104	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC	35	25	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 6HR DN	21	13	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP	280	183	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS DN	543	317	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
YAGUE PRETUMOR DRUG RESISTANCE DN	13	11	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME2 AND H3K27ME3	59	35	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
MURAKAMI UV RESPONSE 1HR DN	10	8	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 10HR DN	30	25	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway
NABA PROTEOGLYCANS	35	23	All SZGR 2.0 genes in this pathway
NABA CORE MATRISOME	275	148	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124/506	273	279	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	273	279	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-133	284	290	m8	hsa-miR-133a	UUGGUCCCCUUCAACCAGCUGU
miR-133	284	290	m8	hsa-miR-133b	UUGGUCCCCUUCAACCAGCUA
miR-24	29	35	m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-339	298	304	m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-374	841	848	1A,m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ACAN