Gene Page: PDXDC1
Summary ?
| GeneID | 23042 |
| Symbol | PDXDC1 |
| Synonyms | LP8165 |
| Description | pyridoxal-dependent decarboxylase domain containing 1 |
| Reference | MIM:614244|HGNC:HGNC:28995|Ensembl:ENSG00000179889|HPRD:13789|Vega:OTTHUMG00000166304 |
| Gene type | protein-coding |
| Map location | 16p13.11 |
| Pascal p-value | 2.056E-5 |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HEATR5B | 0.95 | 0.97 |
| KIF2A | 0.94 | 0.96 |
| USP15 | 0.94 | 0.95 |
| EHBP1 | 0.93 | 0.95 |
| WDR47 | 0.93 | 0.96 |
| PAPD5 | 0.93 | 0.95 |
| CLASP2 | 0.93 | 0.95 |
| RUFY3 | 0.92 | 0.96 |
| AASDHPPT | 0.92 | 0.94 |
| ARFGEF1 | 0.92 | 0.94 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FXYD1 | -0.77 | -0.85 |
| AF347015.31 | -0.77 | -0.85 |
| MT-CO2 | -0.76 | -0.86 |
| HSD17B14 | -0.76 | -0.82 |
| AF347015.33 | -0.75 | -0.82 |
| TSC22D4 | -0.75 | -0.82 |
| HIGD1B | -0.74 | -0.86 |
| IFI27 | -0.74 | -0.84 |
| METRN | -0.74 | -0.87 |
| AF347015.8 | -0.73 | -0.84 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 17353931 | |
| GO:0016829 | lyase activity | IEA | - | |
| GO:0016831 | carboxy-lyase activity | IEA | - | |
| GO:0030170 | pyridoxal phosphate binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0019752 | carboxylic acid metabolic process | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP | 108 | 67 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
| LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
| DARWICHE SKIN TUMOR PROMOTER DN | 185 | 115 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK HIGH DN | 180 | 110 | All SZGR 2.0 genes in this pathway |
| DARWICHE SQUAMOUS CELL CARCINOMA DN | 181 | 107 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL CIS | 128 | 77 | All SZGR 2.0 genes in this pathway |
| CHESLER BRAIN QTL CIS | 75 | 51 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL TRANS | 185 | 114 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL AND BRAIN QTL CIS | 65 | 38 | All SZGR 2.0 genes in this pathway |
| CHESLER BRAIN HIGHEST GENETIC VARIANCE | 37 | 21 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
| COATES MACROPHAGE M1 VS M2 DN | 78 | 44 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
| YOKOE CANCER TESTIS ANTIGENS | 38 | 22 | All SZGR 2.0 genes in this pathway |
| CAMPS COLON CANCER COPY NUMBER DN | 74 | 34 | All SZGR 2.0 genes in this pathway |
| TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| BREDEMEYER RAG SIGNALING NOT VIA ATM DN | 57 | 34 | All SZGR 2.0 genes in this pathway |
| BREDEMEYER RAG SIGNALING VIA ATM NOT VIA NFKB DN | 38 | 23 | All SZGR 2.0 genes in this pathway |
| KYNG WERNER SYNDROM AND NORMAL AGING DN | 225 | 124 | All SZGR 2.0 genes in this pathway |
| KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-182 | 1583 | 1590 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-96 | 1584 | 1590 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.