Gene Page: FOXO1
Summary ?
GeneID | 2308 |
Symbol | FOXO1 |
Synonyms | FKH1|FKHR|FOXO1A |
Description | forkhead box O1 |
Reference | MIM:136533|HGNC:HGNC:3819|Ensembl:ENSG00000150907|HPRD:00645|Vega:OTTHUMG00000016775 |
Gene type | protein-coding |
Map location | 13q14.1 |
Pascal p-value | 0.871 |
Sherlock p-value | 0.314 |
Fetal beta | -1.167 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 1 |
DNM:Guipponi_2014 | Whole Exome Sequencing analysis | 49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0217 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
FOXO1 | G | C | NM_002015 | p.S45S | synonymous | NA | NA | Schizophrenia | DNM:Guipponi_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg26687842 | 13 | 41055491 | FOXO1 | 1.36E-4 | 0.007 | 0.136 | DMG:Montano_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ROBO4 | 0.75 | 0.80 |
KIAA1274 | 0.75 | 0.77 |
PCDH12 | 0.71 | 0.72 |
PIK3R6 | 0.71 | 0.66 |
PXN | 0.70 | 0.73 |
SLC7A5 | 0.70 | 0.72 |
AFAP1L1 | 0.69 | 0.71 |
AL161668.2 | 0.69 | 0.72 |
DAG1 | 0.68 | 0.71 |
SLC38A10 | 0.68 | 0.68 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
UQCRB | -0.47 | -0.56 |
C5orf53 | -0.47 | -0.51 |
USMG5 | -0.46 | -0.64 |
ACOT13 | -0.45 | -0.50 |
NDUFB9 | -0.45 | -0.53 |
SYCP3 | -0.44 | -0.47 |
LY96 | -0.44 | -0.49 |
GSTO1 | -0.44 | -0.53 |
COX7B | -0.44 | -0.49 |
SPHAR | -0.43 | -0.52 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 11353774 |17202144 |18408765 | |
GO:0016563 | transcription activator activity | IDA | 7862145 |10871843 |12228231 | |
GO:0043565 | sequence-specific DNA binding | IDA | 12228231 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001568 | blood vessel development | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0008286 | insulin receptor signaling pathway | IEA | - | |
GO:0006916 | anti-apoptosis | IDA | 10871843 | |
GO:0042127 | regulation of cell proliferation | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IDA | 10871843 |12228231 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 11311120 |12228231 | |
GO:0005737 | cytoplasm | IDA | 11311120 |12228231 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AR | AIS | DHTR | HUMARA | KD | NR3C4 | SBMA | SMAX1 | TFM | androgen receptor | - | HPRD,BioGRID | 12482965 |
CDKN1A | CAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1 | cyclin-dependent kinase inhibitor 1A (p21, Cip1) | FoxO1 binds the distal region of the p21Cip1 promoter. This interaction was modelled on a demonstrated interaction between FoxO1 from an unspecified species and p21Cip1 promoter from an unspecified species. | BIND | 15084259 |
CEBPB | C/EBP-beta | CRP2 | IL6DBP | LAP | MGC32080 | NF-IL6 | TCF5 | CCAAT/enhancer binding protein (C/EBP), beta | - | HPRD,BioGRID | 11893744 |
CREBBP | CBP | KAT3A | RSTS | CREB binding protein | - | HPRD,BioGRID | 10973497 |
CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | beta-catenin interacts with FOXO1. This interaction was modelled on a demonstrated interaction between beta-catenin from an unspecified species and human FOXO1. | BIND | 15905404 |
ESR1 | DKFZp686N23123 | ER | ESR | ESRA | Era | NR3A1 | estrogen receptor 1 | - | HPRD,BioGRID | 11435445 |
FHL2 | AAG11 | DRAL | SLIM3 | four and a half LIM domains 2 | FOXO1A interacts with FHL2. | BIND | 15692560 |
FOXG1 | BF1 | BF2 | FHKL3 | FKH2 | FKHL1 | FKHL2 | FKHL3 | FKHL4 | FOXG1A | FOXG1B | FOXG1C | HBF-1 | HBF-2 | HBF-3 | HBF-G2 | HBF2 | HFK1 | HFK2 | HFK3 | KHL2 | QIN | forkhead box G1 | FoxO1 interacts with FoxG1. This interaction was modelled on an interaction demonstrated between FoxO1 from an unspecified species and mouse FoxG1. | BIND | 15084259 |
G6PC | G6PT | GSD1 | GSD1a | MGC163350 | glucose-6-phosphatase, catalytic subunit | - | HPRD | 11672436 |
HNF4A | FLJ39654 | HNF4 | HNF4a7 | HNF4a8 | HNF4a9 | MODY | MODY1 | NR2A1 | NR2A21 | TCF | TCF14 | hepatocyte nuclear factor 4, alpha | - | HPRD,BioGRID | 12519792 |
HOXA5 | HOX1 | HOX1.3 | HOX1C | MGC9376 | homeobox A5 | - | HPRD,BioGRID | 12163409 |
SIRT1 | SIR2L1 | sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) | FOXO1A interacts with SIRT1. | BIND | 15692560 |
SMAD3 | DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 | SMAD family member 3 | FoxO1 interacts with Smad3. This interaction was modelled on a demonstrated interaction between FoxO1 from an unspecified species and Smad3 from an unspecified species. | BIND | 15084259 |
SMAD3 | DKFZp586N0721 | DKFZp686J10186 | HSPC193 | HsT17436 | JV15-2 | MADH3 | MGC60396 | SMAD family member 3 | - | HPRD,BioGRID | 15084259 |
SMAD4 | DPC4 | JIP | MADH4 | SMAD family member 4 | FoxO1 interacts with Smad4. | BIND | 15084259 |
SMAD4 | DPC4 | JIP | MADH4 | SMAD family member 4 | - | HPRD,BioGRID | 15084259 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | - | HPRD,BioGRID | 10973497 |
TSC2 | FLJ43106 | LAM | TSC4 | tuberous sclerosis 2 | Affinity Capture-Western Co-localization Reconstituted Complex | BioGRID | 17077083 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD,BioGRID | 11237865 |
YWHAZ | KCIP-1 | MGC111427 | MGC126532 | MGC138156 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | - | HPRD,BioGRID | 11237865 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG PROSTATE CANCER | 89 | 75 | All SZGR 2.0 genes in this pathway |
BIOCARTA AKT PATHWAY | 22 | 16 | All SZGR 2.0 genes in this pathway |
SIG INSULIN RECEPTOR PATHWAY IN CARDIAC MYOCYTES | 51 | 41 | All SZGR 2.0 genes in this pathway |
ST PHOSPHOINOSITIDE 3 KINASE PATHWAY | 37 | 29 | All SZGR 2.0 genes in this pathway |
PID SMAD2 3NUCLEAR PATHWAY | 82 | 63 | All SZGR 2.0 genes in this pathway |
PID HDAC CLASSIII PATHWAY | 25 | 20 | All SZGR 2.0 genes in this pathway |
PID ANGIOPOIETIN RECEPTOR PATHWAY | 50 | 41 | All SZGR 2.0 genes in this pathway |
PID CXCR4 PATHWAY | 102 | 78 | All SZGR 2.0 genes in this pathway |
PID FOXO PATHWAY | 49 | 43 | All SZGR 2.0 genes in this pathway |
PID AR TF PATHWAY | 53 | 38 | All SZGR 2.0 genes in this pathway |
PID IL6 7 PATHWAY | 47 | 40 | All SZGR 2.0 genes in this pathway |
PID PI3KCI AKT PATHWAY | 35 | 30 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY SCF KIT | 78 | 59 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K EVENTS IN ERBB4 SIGNALING | 38 | 28 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K EVENTS IN ERBB2 SIGNALING | 44 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING EVENTS OF B CELL RECEPTOR BCR | 97 | 66 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY THE B CELL RECEPTOR BCR | 126 | 90 | All SZGR 2.0 genes in this pathway |
REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR IN DISEASE | 127 | 88 | All SZGR 2.0 genes in this pathway |
REACTOME PI3K AKT ACTIVATION | 38 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME GAB1 SIGNALOSOME | 38 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF BETA CELL DEVELOPMENT | 30 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATION OF GENE EXPRESSION IN BETA CELLS | 20 | 15 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION | 95 | 76 | All SZGR 2.0 genes in this pathway |
REACTOME PI 3K CASCADE | 56 | 39 | All SZGR 2.0 genes in this pathway |
REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR | 100 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME IMMUNE SYSTEM | 933 | 616 | All SZGR 2.0 genes in this pathway |
REACTOME ADAPTIVE IMMUNE SYSTEM | 539 | 350 | All SZGR 2.0 genes in this pathway |
REACTOME PIP3 ACTIVATES AKT SIGNALING | 29 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY FGFR | 112 | 80 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
BARRIER COLON CANCER RECURRENCE UP | 42 | 28 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH NOS TARGETS | 179 | 105 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
TAVOR CEBPA TARGETS DN | 30 | 21 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
RADMACHER AML PROGNOSIS | 78 | 52 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
JAZAERI BREAST CANCER BRCA1 VS BRCA2 DN | 43 | 31 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS | 108 | 71 | All SZGR 2.0 genes in this pathway |
TAKAO RESPONSE TO UVB RADIATION DN | 98 | 67 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS 3HR | 74 | 47 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
ALONSO METASTASIS DN | 26 | 17 | All SZGR 2.0 genes in this pathway |
ZHOU PANCREATIC BETA CELL | 11 | 9 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
GU PDEF TARGETS DN | 39 | 20 | All SZGR 2.0 genes in this pathway |
LINDSTEDT DENDRITIC CELL MATURATION C | 69 | 49 | All SZGR 2.0 genes in this pathway |
LEE EARLY T LYMPHOCYTE DN | 57 | 36 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S3 | 266 | 180 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA DN | 267 | 160 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS EARLY UP | 66 | 44 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS LATE UP | 104 | 67 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE VIA P38 PARTIAL | 160 | 106 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY LUMINAL MATURE DN | 99 | 74 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 426 | 432 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-135 | 3255 | 3262 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-139 | 221 | 227 | 1A | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
miR-142-3p | 274 | 280 | 1A | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-144 | 424 | 430 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-145 | 909 | 915 | m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-153 | 2565 | 2571 | m8 | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-182 | 265 | 271 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-183 | 236 | 242 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-194 | 832 | 838 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-27 | 426 | 432 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-369-3p | 2622 | 2629 | 1A,m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 2623 | 2629 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-378* | 66 | 72 | 1A | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
miR-381 | 3248 | 3254 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-486 | 658 | 664 | m8 | hsa-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
miR-493-5p | 3264 | 3270 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
miR-495 | 689 | 695 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU | ||||
miR-544 | 290 | 297 | 1A,m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
miR-9 | 69 | 75 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 264 | 271 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.