Gene Page: TSSK2
Summary ?
| GeneID | 23617 |
| Symbol | TSSK2 |
| Synonyms | DGS-G|SPOGA2|STK22B|TSK2 |
| Description | testis specific serine kinase 2 |
| Reference | MIM:610710|HGNC:HGNC:11401|Ensembl:ENSG00000206203|HPRD:10255|Vega:OTTHUMG00000150118 |
| Gene type | protein-coding |
| Map location | 22q11.21 |
| Pascal p-value | 0.018 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10994209 | chr10 | 61877705 | TSSK2 | 23617 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0000287 | magnesium ion binding | ISS | - | |
| GO:0005515 | protein binding | IPI | 15044604 | |
| GO:0005524 | ATP binding | ISS | - | |
| GO:0004674 | protein serine/threonine kinase activity | ISS | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006468 | protein amino acid phosphorylation | ISS | - | |
| GO:0007283 | spermatogenesis | IEA | - | |
| GO:0007275 | multicellular organismal development | IEA | - | |
| GO:0030154 | cell differentiation | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KIM WT1 TARGETS 8HR DN | 129 | 84 | All SZGR 2.0 genes in this pathway |
| AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS HCP WITH H3 UNMETHYLATED | 80 | 50 | All SZGR 2.0 genes in this pathway |
| WEBER METHYLATED ICP IN FIBROBLAST | 22 | 9 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES HCP WITH H3 UNMETHYLATED | 63 | 31 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-140 | 129 | 135 | m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
| miR-299-5p | 128 | 134 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-500 | 105 | 112 | 1A,m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.