Gene Page: POU2F3
Summary ?
GeneID | 25833 |
Symbol | POU2F3 |
Synonyms | Epoc-1|OCT-11|OCT11|OTF-11|PLA-1|PLA1|Skn-1a |
Description | POU class 2 homeobox 3 |
Reference | MIM:607394|HGNC:HGNC:19864|Ensembl:ENSG00000137709|HPRD:09582|Vega:OTTHUMG00000166140 |
Gene type | protein-coding |
Map location | 11q23.3 |
Pascal p-value | 2.248E-4 |
eGene | Cortex Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1474539 | chr8 | 133946088 | POU2F3 | 25833 | 0.2 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ABCC9 | 0.79 | 0.76 |
PCDHGC3 | 0.77 | 0.79 |
ITPR2 | 0.76 | 0.76 |
NPAS3 | 0.75 | 0.81 |
BMPR1B | 0.75 | 0.75 |
PPAP2B | 0.73 | 0.68 |
LRIG1 | 0.73 | 0.76 |
RIN2 | 0.73 | 0.77 |
PDLIM5 | 0.71 | 0.66 |
MCC | 0.71 | 0.73 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C20orf7 | -0.32 | -0.36 |
CRYM | -0.32 | -0.29 |
AC034193.4 | -0.31 | -0.37 |
RGS6 | -0.30 | -0.20 |
NDUFA2 | -0.30 | -0.34 |
TIMM10 | -0.29 | -0.24 |
MRPL33 | -0.29 | -0.32 |
COX5A | -0.29 | -0.32 |
GLRX | -0.29 | -0.31 |
COX7B | -0.29 | -0.32 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 12624109 | |
GO:0043565 | sequence-specific DNA binding | IDA | 9242494 | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 10473598 | |
GO:0008544 | epidermis development | TAS | 10473598 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 9242494 | |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
STREICHER LSM1 TARGETS UP | 44 | 34 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION | 77 | 51 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION HBZ | 41 | 27 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION HEMGN | 31 | 21 | All SZGR 2.0 genes in this pathway |
DACOSTA LOW DOSE UV RESPONSE VIA ERCC3 XPCS UP | 18 | 10 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION UP | 142 | 93 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
WANG TUMOR INVASIVENESS UP | 374 | 247 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K27ME3 | 79 | 59 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
DUAN PRDM5 TARGETS | 79 | 52 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-135 | 1438 | 1444 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-323 | 889 | 895 | m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.