Gene Page: PKD2L2
Summary ?
| GeneID | 27039 |
| Symbol | PKD2L2 |
| Synonyms | TRPP5 |
| Description | polycystin 2 like 2, transient receptor potential cation channel |
| Reference | MIM:604669|HGNC:HGNC:9012|Ensembl:ENSG00000078795|HPRD:05238|Vega:OTTHUMG00000163306 |
| Gene type | protein-coding |
| Map location | 5q31 |
| Pascal p-value | 0.003 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MATK | 0.77 | 0.78 |
| SST | 0.76 | 0.80 |
| ST6GALNAC6 | 0.73 | 0.81 |
| DGCR6 | 0.71 | 0.76 |
| FAM131A | 0.71 | 0.80 |
| ATOH7 | 0.70 | 0.71 |
| ADAP1 | 0.70 | 0.78 |
| C21orf2 | 0.69 | 0.69 |
| PTGES2 | 0.69 | 0.75 |
| ICAM5 | 0.69 | 0.79 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MAP4K4 | -0.46 | -0.50 |
| AC005035.1 | -0.44 | -0.47 |
| EIF5B | -0.43 | -0.52 |
| KIAA1949 | -0.42 | -0.38 |
| THOC2 | -0.41 | -0.45 |
| ATAD2B | -0.41 | -0.42 |
| UPF3B | -0.40 | -0.49 |
| MLLT3 | -0.40 | -0.25 |
| CDK5RAP2 | -0.40 | -0.40 |
| PHF16 | -0.40 | -0.38 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005515 | protein binding | NAS | 10602361 | |
| GO:0005216 | ion channel activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008150 | biological_process | ND | - | |
| GO:0006811 | ion transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | TAS | 10602361 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-365 | 194 | 200 | m8 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.