Gene Page: GJB2
Summary ?
| GeneID | 2706 |
| Symbol | GJB2 |
| Synonyms | CX26|DFNA3|DFNA3A|DFNB1|DFNB1A|HID|KID|NSRD1|PPK |
| Description | gap junction protein beta 2 |
| Reference | MIM:121011|HGNC:HGNC:4284|Ensembl:ENSG00000165474|HPRD:00413|Vega:OTTHUMG00000016513 |
| Gene type | protein-coding |
| Map location | 13q11-q12 |
| Pascal p-value | 0.516 |
| Fetal beta | 0.966 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg00347757 | 13 | 20768560 | GJB2 | 8.49E-5 | 0.584 | 0.026 | DMG:Wockner_2014 |
| cg07921371 | 13 | 20768536 | GJB2 | 1.577E-4 | 0.496 | 0.032 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs4483706 | chr13 | 20939063 | GJB2 | 2706 | 0.09 | cis | ||
| rs17131472 | chr1 | 91962966 | GJB2 | 2706 | 1.904E-4 | trans | ||
| rs546975 | chr1 | 91963738 | GJB2 | 2706 | 0.05 | trans | ||
| rs17821815 | chr2 | 119018522 | GJB2 | 2706 | 0.19 | trans | ||
| rs16825495 | chr2 | 134234401 | GJB2 | 2706 | 0.05 | trans | ||
| rs1691463 | chr3 | 84914366 | GJB2 | 2706 | 0.08 | trans | ||
| rs2922180 | chr3 | 125280472 | GJB2 | 2706 | 9.442E-6 | trans | ||
| rs2971271 | chr3 | 125450402 | GJB2 | 2706 | 0.02 | trans | ||
| rs2976809 | chr3 | 125451738 | GJB2 | 2706 | 8.446E-6 | trans | ||
| rs17381134 | chr4 | 157179855 | GJB2 | 2706 | 0.06 | trans | ||
| rs13136254 | chr4 | 184824883 | GJB2 | 2706 | 0.05 | trans | ||
| rs10050805 | chr5 | 30805352 | GJB2 | 2706 | 7.367E-4 | trans | ||
| rs837115 | chr5 | 40736290 | GJB2 | 2706 | 0.07 | trans | ||
| rs317971 | chr5 | 66688724 | GJB2 | 2706 | 0.02 | trans | ||
| rs248049 | chr5 | 126489320 | GJB2 | 2706 | 0.16 | trans | ||
| rs17135501 | chr6 | 2704474 | GJB2 | 2706 | 0.02 | trans | ||
| rs17135521 | chr6 | 2707631 | GJB2 | 2706 | 0.02 | trans | ||
| snp_a-1787926 | 0 | GJB2 | 2706 | 0.02 | trans | |||
| rs9381511 | chr6 | 12931447 | GJB2 | 2706 | 0.07 | trans | ||
| rs6934246 | chr6 | 35154494 | GJB2 | 2706 | 8.406E-4 | trans | ||
| rs12663807 | chr6 | 40571873 | GJB2 | 2706 | 0.12 | trans | ||
| rs4236095 | chr6 | 47368686 | GJB2 | 2706 | 0.07 | trans | ||
| rs6455226 | chr6 | 67930295 | GJB2 | 2706 | 1.21E-5 | trans | ||
| rs2498649 | chr6 | 139401923 | GJB2 | 2706 | 0.13 | trans | ||
| rs10085826 | chr7 | 42504690 | GJB2 | 2706 | 0.13 | trans | ||
| rs2430483 | chr7 | 104548631 | GJB2 | 2706 | 0.03 | trans | ||
| rs2199402 | chr8 | 9201002 | GJB2 | 2706 | 0.03 | trans | ||
| rs7841407 | chr8 | 9243427 | GJB2 | 2706 | 0 | trans | ||
| rs2739708 | chr8 | 17992280 | GJB2 | 2706 | 0.01 | trans | ||
| rs714131 | chr8 | 17992832 | GJB2 | 2706 | 0.01 | trans | ||
| rs2739726 | chr8 | 17998576 | GJB2 | 2706 | 0.17 | trans | ||
| rs680372 | chr8 | 36999626 | GJB2 | 2706 | 0.01 | trans | ||
| rs2061799 | chr9 | 97795003 | GJB2 | 2706 | 0.03 | trans | ||
| rs4743989 | chr9 | 97859191 | GJB2 | 2706 | 0.09 | trans | ||
| rs356660 | chr9 | 98006134 | GJB2 | 2706 | 0.19 | trans | ||
| rs651134 | chr10 | 27549960 | GJB2 | 2706 | 0.09 | trans | ||
| rs7081666 | chr10 | 47673800 | GJB2 | 2706 | 0 | trans | ||
| rs11006556 | chr10 | 61287609 | GJB2 | 2706 | 0.09 | trans | ||
| rs1159612 | chr10 | 85329057 | GJB2 | 2706 | 0 | trans | ||
| rs11049036 | chr12 | 27650292 | GJB2 | 2706 | 0 | trans | ||
| rs7303819 | chr12 | 33990776 | GJB2 | 2706 | 0.18 | trans | ||
| rs10879027 | chr12 | 70237156 | GJB2 | 2706 | 2.163E-4 | trans | ||
| rs9529974 | chr13 | 72821935 | GJB2 | 2706 | 0.05 | trans | ||
| rs17073665 | chr13 | 81541961 | GJB2 | 2706 | 0 | trans | ||
| rs9301825 | chr13 | 93269485 | GJB2 | 2706 | 0.11 | trans | ||
| rs1457420 | chr14 | 66958675 | GJB2 | 2706 | 0.01 | trans | ||
| rs17244419 | chr14 | 97171074 | GJB2 | 2706 | 0.18 | trans | ||
| rs8034402 | chr15 | 55480932 | GJB2 | 2706 | 0.17 | trans | ||
| rs8043029 | chr15 | 55486010 | GJB2 | 2706 | 0.12 | trans | ||
| rs3809540 | chr15 | 55489411 | GJB2 | 2706 | 0.19 | trans | ||
| rs17137819 | chr16 | 5372534 | GJB2 | 2706 | 0.05 | trans | ||
| rs16958302 | chr16 | 57647432 | GJB2 | 2706 | 0 | trans | ||
| rs11873703 | chr18 | 61448702 | GJB2 | 2706 | 0.03 | trans | ||
| rs6095741 | chr20 | 48666589 | GJB2 | 2706 | 2.198E-12 | trans | ||
| rs7265852 | chr20 | 48823717 | GJB2 | 2706 | 0.16 | trans | ||
| rs5915713 | chrX | 4077883 | GJB2 | 2706 | 0.06 | trans | ||
| rs5991662 | chrX | 43335796 | GJB2 | 2706 | 1.313E-6 | trans | ||
| rs1545676 | chrX | 93530472 | GJB2 | 2706 | 2.258E-6 | trans | ||
| rs242163 | chrX | 132311662 | GJB2 | 2706 | 0.01 | trans | ||
| rs10521801 | chrX | 138732866 | GJB2 | 2706 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| GO:0005243 | gap junction channel activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007267 | cell-cell signaling | TAS | 1324944 | |
| GO:0007605 | sensory perception of sound | TAS | 9139825 |9482292 | |
| GO:0006810 | transport | TAS | 1324944 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | EXP | 11719551 | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005922 | connexon complex | TAS | 1324944 | |
| GO:0005886 | plasma membrane | EXP | 11719551 | |
| GO:0005886 | plasma membrane | TAS | 1324944 | |
| GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
| REACTOME GAP JUNCTION TRAFFICKING | 27 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME GAP JUNCTION ASSEMBLY | 18 | 12 | All SZGR 2.0 genes in this pathway |
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
| LANDIS ERBB2 BREAST TUMORS 324 DN | 149 | 93 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA PROGRESSION RISK | 74 | 44 | All SZGR 2.0 genes in this pathway |
| AIGNER ZEB1 TARGETS | 35 | 15 | All SZGR 2.0 genes in this pathway |
| SCHLESINGER METHYLATED DE NOVO IN CANCER | 88 | 64 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY DN | 110 | 64 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| ROZANOV MMP14 TARGETS SUBSET | 33 | 20 | All SZGR 2.0 genes in this pathway |
| ROZANOV MMP14 TARGETS UP | 266 | 171 | All SZGR 2.0 genes in this pathway |
| SESTO RESPONSE TO UV C8 | 72 | 56 | All SZGR 2.0 genes in this pathway |
| JACKSON DNMT1 TARGETS DN | 25 | 21 | All SZGR 2.0 genes in this pathway |
| WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
| GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| COULOUARN TEMPORAL TGFB1 SIGNATURE DN | 138 | 99 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD2 DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 6 | 75 | 48 | All SZGR 2.0 genes in this pathway |
| NOUSHMEHR GBM SILENCED BY METHYLATION | 50 | 32 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
| OHGUCHI LIVER HNF4A TARGETS DN | 149 | 85 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
| KATSANOU ELAVL1 TARGETS DN | 148 | 88 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY LUMINAL PROGENITOR UP | 58 | 30 | All SZGR 2.0 genes in this pathway |
| GHANDHI BYSTANDER IRRADIATION UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-421 | 46 | 53 | 1A,m8 | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.