Gene Page: BIN1
Summary ?
GeneID | 274 |
Symbol | BIN1 |
Synonyms | AMPH2|AMPHL|SH3P9 |
Description | bridging integrator 1 |
Reference | MIM:601248|HGNC:HGNC:1052|Ensembl:ENSG00000136717|HPRD:03150|Vega:OTTHUMG00000131465 |
Gene type | protein-coding |
Map location | 2q14 |
Pascal p-value | 0.009 |
Sherlock p-value | 0.956 |
Fetal beta | -1.322 |
DMG | 2 (# studies) |
eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:vanEijk_2014 | Genome-wide DNA methylation analysis | This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). | 3 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 3 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.023 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00755 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.005 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg06021088 | 2 | 127822551 | BIN1 | 4.214E-4 | -0.36 | 0.045 | DMG:Wockner_2014 |
cg17105014 | 2 | 127413363 | BIN1 | 3.03E-5 | 4.909 | DMG:vanEijk_2014 | |
cg17105014 | 2 | 127413363 | BIN1 | 9.35E-5 | 4.417 | DMG:vanEijk_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1578978 | chr8 | 118196802 | BIN1 | 274 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030100 | regulation of endocytosis | IEA | - | |
GO:0008283 | cell proliferation | TAS | 8782822 | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0045786 | negative regulation of cell cycle | IEA | - | |
GO:0044419 | interspecies interaction between organisms | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0015629 | actin cytoskeleton | TAS | 9182667 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABL1 | ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl | c-abl oncogene 1, receptor tyrosine kinase | - | HPRD | 9356459 |
AMPH | AMPH1 | amphiphysin | - | HPRD,BioGRID | 9348539 |
AP2A1 | ADTAA | AP2-ALPHA | CLAPA1 | adaptor-related protein complex 2, alpha 1 subunit | - | HPRD | 9280305 |
AP2A2 | ADTAB | CLAPA2 | HIP9 | HYPJ | adaptor-related protein complex 2, alpha 2 subunit | - | HPRD | 10430869 |
BIN1 | AMPH2 | AMPHL | DKFZp547F068 | MGC10367 | SH3P9 | bridging integrator 1 | - | HPRD,BioGRID | 10391921 |
CUX1 | CASP | CDP | CDP/Cut | CDP1 | COY1 | CUTL1 | CUX | Clox | Cux/CDP | GOLIM6 | Nbla10317 | p100 | p110 | p200 | p75 | cut-like homeobox 1 | Two-hybrid | BioGRID | 16169070 |
DNM1 | DNM | dynamin 1 | - | HPRD,BioGRID | 9195986 |9280305 |
ITGA1 | CD49a | VLA1 | integrin, alpha 1 | - | HPRD,BioGRID | 10094488 |
ITGA3 | CD49C | FLJ34631 | FLJ34704 | GAP-B3 | GAPB3 | MSK18 | VCA-2 | VL3A | VLA3a | integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) | - | HPRD,BioGRID | 10094488 |
MAP4K3 | GLK | MAPKKKK3 | RAB8IPL1 | mitogen-activated protein kinase kinase kinase kinase 3 | - | HPRD | 11384986 |
PLD1 | - | phospholipase D1, phosphatidylcholine-specific | Phenotypic Suppression Reconstituted Complex | BioGRID | 10764771 |
PLD2 | - | phospholipase D2 | - | HPRD,BioGRID | 10764771 |
PTK2 | FADK | FAK | FAK1 | pp125FAK | PTK2 protein tyrosine kinase 2 | - | HPRD,BioGRID | 12558988 |
RIN2 | RASSF4 | Ras and Rab interactor 2 | - | HPRD | 12972505 |
RIN3 | DKFZp762H1613 | FLJ11700 | FLJ22439 | Ras and Rab interactor 3 | - | HPRD,BioGRID | 12972505 |
SH3GL2 | CNSA2 | EEN-B1 | FLJ20276 | FLJ25015 | SH3D2A | SH3P4 | SH3-domain GRB2-like 2 | - | HPRD | 9315708 |
SH3GL2 | CNSA2 | EEN-B1 | FLJ20276 | FLJ25015 | SH3D2A | SH3P4 | SH3-domain GRB2-like 2 | Reconstituted Complex | BioGRID | 12456676 |
SH3GLB1 | Bif-1 | CGI-61 | KIAA0491 | dJ612B15.2 | SH3-domain GRB2-like endophilin B1 | - | HPRD,BioGRID | 12456676 |
SNX4 | - | sorting nexin 4 | - | HPRD,BioGRID | 12668730 |
SYN1 | SYN1a | SYN1b | SYNI | synapsin I | - | HPRD,BioGRID | 10899172 |
SYNJ1 | INPP5G | synaptojanin 1 | - | HPRD,BioGRID | 9195986 |9341169 |
XRCC5 | FLJ39089 | KARP-1 | KARP1 | KU80 | KUB2 | Ku86 | NFIV | X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining) | Co-purification | BioGRID | 17671430 |
XRCC6 | CTC75 | CTCBF | G22P1 | KU70 | ML8 | TLAA | X-ray repair complementing defective repair in Chinese hamster cells 6 | Co-purification | BioGRID | 17671430 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BIOCARTA NDKDYNAMIN PATHWAY | 21 | 15 | All SZGR 2.0 genes in this pathway |
PID P73PATHWAY | 79 | 59 | All SZGR 2.0 genes in this pathway |
PID ARF6 TRAFFICKING PATHWAY | 49 | 34 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
PRAMOONJAGO SOX4 TARGETS DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
GAL LEUKEMIC STEM CELL UP | 133 | 78 | All SZGR 2.0 genes in this pathway |
RODRIGUES NTN1 TARGETS DN | 158 | 102 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 1 DN | 242 | 165 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS DN | 161 | 93 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN | 45 | 34 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
EBAUER MYOGENIC TARGETS OF PAX3 FOXO1 FUSION | 50 | 26 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 SIGNALING VIA CTNNB1 | 83 | 58 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS B LYMPHOCYTE DN | 38 | 25 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
BROWN MYELOID CELL DEVELOPMENT DN | 129 | 86 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
MODY HIPPOCAMPUS POSTNATAL | 63 | 50 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS DN | 74 | 55 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DELASERNA MYOD TARGETS UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
JACKSON DNMT1 TARGETS UP | 77 | 57 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
WALLACE JAK2 TARGETS UP | 26 | 15 | All SZGR 2.0 genes in this pathway |
HOFFMANN PRE BI TO LARGE PRE BII LYMPHOCYTE DN | 75 | 61 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS DN | 213 | 127 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-22 | 362 | 368 | m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-377 | 27 | 33 | 1A | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-9 | 147 | 153 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.