Gene Page: GNAZ
Summary ?
| GeneID | 2781 |
| Symbol | GNAZ |
| Synonyms | - |
| Description | G protein subunit alpha z |
| Reference | MIM:139160|HGNC:HGNC:4395|Ensembl:ENSG00000128266|HPRD:00746|Vega:OTTHUMG00000150611 |
| Gene type | protein-coding |
| Map location | 22q11.22 |
| Pascal p-value | 0.691 |
| Sherlock p-value | 0.176 |
| Fetal beta | 0.673 |
| eGene | Nucleus accumbens basal ganglia Meta |
| Support | G-PROTEIN RELAY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.2005 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC073995.1 | 0.59 | 0.47 |
| ANAPC4 | 0.56 | 0.60 |
| GRB14 | 0.55 | 0.59 |
| AC027807.2 | 0.54 | 0.43 |
| KCNMB3 | 0.54 | 0.37 |
| AC087071.1 | 0.54 | 0.48 |
| AC022692.2 | 0.54 | 0.39 |
| SNHG12 | 0.53 | 0.44 |
| DNAJC2 | 0.53 | 0.63 |
| MTERFD3 | 0.51 | 0.53 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CASKIN2 | -0.49 | -0.51 |
| A4GALT | -0.46 | -0.52 |
| SLC2A1 | -0.46 | -0.46 |
| HLA-E | -0.45 | -0.51 |
| SLC9A3R1 | -0.45 | -0.54 |
| MAPKAPK3 | -0.45 | -0.53 |
| MOCS1 | -0.45 | -0.46 |
| PPP1R13L | -0.44 | -0.52 |
| ALDH2 | -0.44 | -0.49 |
| FOXO4 | -0.44 | -0.52 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005057 | receptor signaling protein activity | TAS | 2456569 | |
| GO:0003924 | GTPase activity | TAS | 2117645 | |
| GO:0005525 | GTP binding | IEA | - | |
| GO:0019001 | guanyl nucleotide binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | TAS | 3129724 | |
| GO:0007165 | signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005635 | nuclear envelope | TAS | 2117645 | |
| GO:0005737 | cytoplasm | IDA | 18029348 | |
| GO:0005783 | endoplasmic reticulum | TAS | 2117645 | |
| GO:0005886 | plasma membrane | TAS | 3129724 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG LONG TERM DEPRESSION | 70 | 53 | All SZGR 2.0 genes in this pathway |
| PID ENDOTHELIN PATHWAY | 63 | 52 | All SZGR 2.0 genes in this pathway |
| PID LYSOPHOSPHOLIPID PATHWAY | 66 | 53 | All SZGR 2.0 genes in this pathway |
| PID ER NONGENOMIC PATHWAY | 41 | 35 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P3 PATHWAY | 29 | 24 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P4 PATHWAY | 14 | 11 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P1 PATHWAY | 21 | 18 | All SZGR 2.0 genes in this pathway |
| PID CXCR4 PATHWAY | 102 | 78 | All SZGR 2.0 genes in this pathway |
| PID S1P META PATHWAY | 21 | 14 | All SZGR 2.0 genes in this pathway |
| PID AR NONGENOMIC PATHWAY | 31 | 27 | All SZGR 2.0 genes in this pathway |
| PID HEDGEHOG GLI PATHWAY | 48 | 35 | All SZGR 2.0 genes in this pathway |
| PID CXCR3 PATHWAY | 43 | 34 | All SZGR 2.0 genes in this pathway |
| PID THROMBIN PAR1 PATHWAY | 43 | 32 | All SZGR 2.0 genes in this pathway |
| PID S1P S1P2 PATHWAY | 24 | 19 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME OPIOID SIGNALLING | 78 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME PLC BETA MEDIATED EVENTS | 43 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME G PROTEIN ACTIVATION | 27 | 15 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA I SIGNALLING EVENTS | 195 | 114 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA Z SIGNALLING EVENTS | 44 | 29 | All SZGR 2.0 genes in this pathway |
| TERAMOTO OPN TARGETS CLUSTER 4 | 13 | 8 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
| KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER METASTASIS DN | 121 | 65 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 20HR UP | 240 | 152 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER POOR PROGNOSIS | 55 | 30 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-129-5p | 637 | 643 | m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
| hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
| miR-186 | 858 | 864 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| miR-27 | 1260 | 1266 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-331 | 80 | 86 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
| miR-450 | 637 | 643 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
| miR-452 | 153 | 160 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
| miR-542-3p | 273 | 280 | 1A,m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.