Gene Page: GPM6B
Summary ?
GeneID | 2824 |
Symbol | GPM6B |
Synonyms | M6B |
Description | glycoprotein M6B |
Reference | MIM:300051|HGNC:HGNC:4461|Ensembl:ENSG00000046653|HPRD:02082|Vega:OTTHUMG00000021162 |
Gene type | protein-coding |
Map location | Xp22.2 |
Sherlock p-value | 0.002 |
DEG p-value | DEG:Zhao_2015:p=5.77e-04:q=0.0926 |
Fetal beta | -1.133 |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003674 | molecular_function | ND | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007399 | nervous system development | NAS | neurite (GO term level: 5) | 8661015 |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 18029348 | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | NAS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP | 59 | 38 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION UP | 64 | 37 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN | 198 | 110 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST DUCTAL CARCINOMA VS LOBULAR NORMAL DN | 69 | 43 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST LOBULAR CARCINOMA VS LOBULAR NORMAL UP | 94 | 59 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
CHEBOTAEV GR TARGETS DN | 120 | 73 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID UP | 45 | 26 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
KAN RESPONSE TO ARSENIC TRIOXIDE | 123 | 80 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL UP | 83 | 51 | All SZGR 2.0 genes in this pathway |
CEBALLOS TARGETS OF TP53 AND MYC DN | 38 | 31 | All SZGR 2.0 genes in this pathway |
YANG BREAST CANCER ESR1 LASER DN | 50 | 38 | All SZGR 2.0 genes in this pathway |
INGRAM SHH TARGETS DN | 64 | 41 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA MF UP | 47 | 27 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED DN | 246 | 180 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
KONDO PROSTATE CANCER WITH H3K27ME3 | 196 | 93 | All SZGR 2.0 genes in this pathway |
HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER DN | 6 | 6 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B DN | 564 | 326 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
ROSS LEUKEMIA WITH MLL FUSIONS | 78 | 49 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS SIGNALING UP | 41 | 24 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
KORKOLA EMBRYONIC CARCINOMA VS SEMINOMA UP | 22 | 15 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN | 74 | 47 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 10HR UP | 54 | 38 | All SZGR 2.0 genes in this pathway |
WANG MLL TARGETS | 289 | 188 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 757 | 764 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 757 | 763 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-135 | 1115 | 1121 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-141/200a | 866 | 872 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG | ||||
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG | ||||
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-155 | 1728 | 1735 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-186 | 176 | 182 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-194 | 1821 | 1827 | 1A | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
miR-217 | 64 | 70 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-299-5p | 896 | 902 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-30-5p | 926 | 932 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-376c | 1287 | 1293 | 1A | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
hsa-miR-376c | AACAUAGAGGAAAUUCCACG | ||||
miR-384 | 146 | 153 | 1A,m8 | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
miR-496 | 1720 | 1726 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-96 | 1790 | 1796 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.