SZGR2

Summary ?

GeneID	29
Symbol	ABR
Synonyms	MDB
Description	active BCR-related
Reference	MIM:600365\|HGNC:HGNC:81\|Ensembl:ENSG00000159842\|HPRD:02649\|Vega:OTTHUMG00000090313
Gene type	protein-coding
Map location	17p13.3
Pascal p-value	0.391
Sherlock p-value	0.395
Fetal beta	-1.119
DMG	2 (# studies)
Support	CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09732966	17	1083309	ABR	3.846E-4	0.647	0.043	DMG:Wockner_2014
cg10687217	17	1085135	ABR	4.866E-4	0.403	0.047	DMG:Wockner_2014
cg19816938	17	1082526	ABR	6.11E-8	-0.008	1.53E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CPT1A	0.85	0.83
ACSS1	0.85	0.83
FYCO1	0.85	0.86
TPCN1	0.84	0.79
ITPKB	0.84	0.80
CHDH	0.83	0.73
OPLAH	0.82	0.75
FAM38A	0.82	0.77
DOCK1	0.82	0.81
ATP1A2	0.80	0.76

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
VPS29	-0.49	-0.55
MED19	-0.49	-0.54
C12orf73	-0.49	-0.53
TAF9	-0.49	-0.52
NT5C3L	-0.48	-0.55
PSMA6	-0.47	-0.58
POLB	-0.47	-0.52
STMN1	-0.46	-0.48
TXNL1	-0.46	-0.51
DCUN1D5	-0.46	-0.48

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005089	Rho guanyl-nucleotide exchange factor activity	IEA		-
GO:0005085	guanyl-nucleotide exchange factor activity	IEA		-
GO:0005096	GTPase activator activity	TAS		8262969
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	IEA	Brain (GO term level: 7)	-
GO:0007242	intracellular signaling cascade	IEA		-
GO:0007264	small GTPase mediated signal transduction	TAS		8262969
GO:0035023	regulation of Rho protein signal transduction	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID RHOA REG PATHWAY	46	30	All SZGR 2.0 genes in this pathway
PID RAC1 REG PATHWAY	38	25	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY RHO GTPASES	113	81	All SZGR 2.0 genes in this pathway
REACTOME SIGNALLING BY NGF	217	167	All SZGR 2.0 genes in this pathway
REACTOME NRAGE SIGNALS DEATH THROUGH JNK	43	33	All SZGR 2.0 genes in this pathway
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE	60	43	All SZGR 2.0 genes in this pathway
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING	81	61	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA1213 SIGNALLING EVENTS	74	56	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE DN	92	51	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA UP	783	507	All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP	276	187	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP	418	263	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE DN	76	52	All SZGR 2.0 genes in this pathway
ROSS ACUTE MYELOID LEUKEMIA CBF	82	57	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS DN	87	69	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS DN	74	55	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE UP	163	102	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
YOSHIOKA LIVER CANCER EARLY RECURRENCE DN	65	31	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN	56	39	All SZGR 2.0 genes in this pathway
KYNG WERNER SYNDROM AND NORMAL AGING DN	225	124	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE NOT VIA P38	337	236	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-122	101	107	1A	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-124.1	1161	1167	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1161	1167	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1161	1167	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-125/351	1637	1643	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	1637	1643	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-145	133	140	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-19	2547	2554	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	2547	2554	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-299-5p	2498	2505	1A,m8	hsa-miR-299-5p	UGGUUUACCGUCCCACAUACAU
miR-34/449	1194	1201	1A,m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-369-3p	2484	2490	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-370	2291	2297	m8	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-374	2484	2491	1A,m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-493-5p	164	170	1A	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-496	2496	2502	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-543	2517	2523	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-544	284	290	1A	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ABR