Gene Page: ZDHHC8
Summary ?
| GeneID | 29801 |
| Symbol | ZDHHC8 |
| Synonyms | DHHC8|ZDHHCL1|ZNF378 |
| Description | zinc finger DHHC-type containing 8 |
| Reference | MIM:608784|HGNC:HGNC:18474|Ensembl:ENSG00000099904|HPRD:12298|Vega:OTTHUMG00000150499 |
| Gene type | protein-coding |
| Map location | 22q11.21 |
| Pascal p-value | 9.066E-5 |
| Sherlock p-value | 0.122 |
| Fetal beta | -0.181 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
| GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016740 | transferase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0008415 | acyltransferase activity | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0031410 | cytoplasmic vesicle | IEA | - | |
| GO:0030659 | cytoplasmic vesicle membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| STARK HYPPOCAMPUS 22Q11 DELETION DN | 20 | 19 | All SZGR 2.0 genes in this pathway |
| CAMPS COLON CANCER COPY NUMBER UP | 92 | 45 | All SZGR 2.0 genes in this pathway |
| BOUDOUKHA BOUND BY IGF2BP2 | 111 | 59 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 703 | 709 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-133 | 35 | 41 | m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-218 | 959 | 965 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU | ||||
| miR-335 | 722 | 728 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.