SZGR2

Summary ?

GeneID	3358
Symbol	HTR2C
Synonyms	5-HT1C\|5-HT2C\|5-HTR2C\|5HTR2C\|HTR1C
Description	5-hydroxytryptamine receptor 2C
Reference	MIM:312861\|HGNC:HGNC:5295\|Ensembl:ENSG00000147246\|HPRD:02429\|Vega:OTTHUMG00000022226
Gene type	protein-coding
Map location	Xq24
Fetal beta	-0.534
eGene	Myers' cis & trans
Support	Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
ADT:Sun_2012	Systematic Investigation of Antipsychotic Drugs and Their Targets	A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs3793249	chr7	29970596	HTR2C	3358	0.15	trans
rs17158518	chr7	29971956	HTR2C	3358	0.15	trans
rs17158520	chr7	29973648	HTR2C	3358	0.15	trans
rs1003749	chr7	29998723	HTR2C	3358	0.15	trans
rs10962066	chr9	15555037	HTR2C	3358	0.13	trans
rs4741528	chr9	15655977	HTR2C	3358	0.03	trans
rs6474944	chr9	15670444	HTR2C	3358	0.04	trans
rs6474952	chr9	15711233	HTR2C	3358	0.14	trans
rs10756697	chr9	15728516	HTR2C	3358	0.17	trans
rs1891212	chr9	15900770	HTR2C	3358	0.09	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005515	protein binding	IPI		16319069
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	9241279
GO:0007186	G-protein coupled receptor protein signaling pathway	IEA		-
GO:0007165	signal transduction	IEA		-
GO:0007631	feeding behavior	TAS		7700379
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION	90	68	All SZGR 2.0 genes in this pathway
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK	205	136	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS	305	177	All SZGR 2.0 genes in this pathway
REACTOME AMINE LIGAND BINDING RECEPTORS	38	33	All SZGR 2.0 genes in this pathway
REACTOME SEROTONIN RECEPTORS	12	11	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA Q SIGNALLING EVENTS	184	116	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING	408	246	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN	205	127	All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL DN	118	79	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS UP	149	84	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
LEIN MIDBRAIN MARKERS	82	55	All SZGR 2.0 genes in this pathway
LEIN PONS MARKERS	89	59	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED	536	296	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3	102	76	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED	228	119	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	2495	2501	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	2495	2501	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	2495	2501	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-137	2179	2185	1A	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-140	390	396	1A	hsa-miR-140^brain	AGUGGUUUUACCCUAUGGUAG
miR-143	331	338	1A,m8	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-15/16/195/424/497	1339	1345	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-182	1732	1738	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-214	1337	1343	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-216	164	170	m8	hsa-miR-216	UAAUCUCAGCUGGCAACUGUG
miR-219	145	151	1A	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-22	1215	1221	1A	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-23	1077	1084	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1077	1084	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	1077	1083	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-324-3p	1671	1677	m8	hsa-miR-324-3p	CCACUGCCCCAGGUGCUGCUGG
miR-326	826	832	m8	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-34/449	1729	1736	1A,m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-34b	2493	2499	m8	hsa-miR-34b	UAGGCAGUGUCAUUAGCUGAUUG
miR-379	1785	1791	m8	hsa-miR-379^brain	UGGUAGACUAUGGAACGUA
miR-384	44	50	1A	hsa-miR-384	AUUCCUAGAAAUUGUUCAUA
miR-455	1917	1923	1A	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG
miR-485-3p	2314	2320	1A	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-495	2213	2219	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	86	92	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-96	1732	1738	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HTR2C