Gene Page: HTR2C
Summary ?
GeneID | 3358 |
Symbol | HTR2C |
Synonyms | 5-HT1C|5-HT2C|5-HTR2C|5HTR2C|HTR1C |
Description | 5-hydroxytryptamine receptor 2C |
Reference | MIM:312861|HGNC:HGNC:5295|Ensembl:ENSG00000147246|HPRD:02429|Vega:OTTHUMG00000022226 |
Gene type | protein-coding |
Map location | Xq24 |
Fetal beta | -0.534 |
eGene | Myers' cis & trans |
Support | Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
ADT:Sun_2012 | Systematic Investigation of Antipsychotic Drugs and Their Targets | A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs3793249 | chr7 | 29970596 | HTR2C | 3358 | 0.15 | trans | ||
rs17158518 | chr7 | 29971956 | HTR2C | 3358 | 0.15 | trans | ||
rs17158520 | chr7 | 29973648 | HTR2C | 3358 | 0.15 | trans | ||
rs1003749 | chr7 | 29998723 | HTR2C | 3358 | 0.15 | trans | ||
rs10962066 | chr9 | 15555037 | HTR2C | 3358 | 0.13 | trans | ||
rs4741528 | chr9 | 15655977 | HTR2C | 3358 | 0.03 | trans | ||
rs6474944 | chr9 | 15670444 | HTR2C | 3358 | 0.04 | trans | ||
rs6474952 | chr9 | 15711233 | HTR2C | 3358 | 0.14 | trans | ||
rs10756697 | chr9 | 15728516 | HTR2C | 3358 | 0.17 | trans | ||
rs1891212 | chr9 | 15900770 | HTR2C | 3358 | 0.09 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004872 | receptor activity | IEA | - | |
GO:0005515 | protein binding | IPI | 16319069 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 9241279 |
GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
GO:0007631 | feeding behavior | TAS | 7700379 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
KEGG GAP JUNCTION | 90 | 68 | All SZGR 2.0 genes in this pathway |
REACTOME GASTRIN CREB SIGNALLING PATHWAY VIA PKC AND MAPK | 205 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
REACTOME AMINE LIGAND BINDING RECEPTORS | 38 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME SEROTONIN RECEPTORS | 12 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA Q SIGNALLING EVENTS | 184 | 116 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL DN | 118 | 79 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS UP | 149 | 84 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
LEIN PONS MARKERS | 89 | 59 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3 UNMETHYLATED | 228 | 119 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 2495 | 2501 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 2495 | 2501 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-137 | 2179 | 2185 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-140 | 390 | 396 | 1A | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
miR-143 | 331 | 338 | 1A,m8 | hsa-miR-143brain | UGAGAUGAAGCACUGUAGCUCA |
miR-15/16/195/424/497 | 1339 | 1345 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-182 | 1732 | 1738 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-214 | 1337 | 1343 | m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
miR-216 | 164 | 170 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
miR-219 | 145 | 151 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
miR-22 | 1215 | 1221 | 1A | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-23 | 1077 | 1084 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 1077 | 1083 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-324-3p | 1671 | 1677 | m8 | hsa-miR-324-3p | CCACUGCCCCAGGUGCUGCUGG |
miR-326 | 826 | 832 | m8 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
miR-34/449 | 1729 | 1736 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-34b | 2493 | 2499 | m8 | hsa-miR-34b | UAGGCAGUGUCAUUAGCUGAUUG |
miR-379 | 1785 | 1791 | m8 | hsa-miR-379brain | UGGUAGACUAUGGAACGUA |
miR-384 | 44 | 50 | 1A | hsa-miR-384 | AUUCCUAGAAAUUGUUCAUA |
miR-455 | 1917 | 1923 | 1A | hsa-miR-455 | UAUGUGCCUUUGGACUACAUCG |
miR-485-3p | 2314 | 2320 | 1A | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-495 | 2213 | 2219 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-496 | 86 | 92 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-96 | 1732 | 1738 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.