SZGR2

Summary ?

GeneID	3479
Symbol	IGF1
Synonyms	IGF-I\|IGFI\|MGF
Description	insulin like growth factor 1
Reference	MIM:147440\|HGNC:HGNC:5464\|Ensembl:ENSG00000017427\|HPRD:00936\|Vega:OTTHUMG00000149910
Gene type	protein-coding
Map location	12q23.2
Pascal p-value	0.339
Fetal beta	-1.233
eGene	Cerebellar Hemisphere Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1911875	chr4	132293356	IGF1	3479		0.12		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005179	hormone activity	IEA		-
GO:0005179	hormone activity	TAS		9681507
GO:0005159	insulin-like growth factor receptor binding	IPI		8452530
GO:0005159	insulin-like growth factor receptor binding	TAS		10749889
GO:0005158	insulin receptor binding	IPI		8452530
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	IPI		10766744
GO:0008083	growth factor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0010001	glial cell differentiation	IEA	Glial (GO term level: 8)	-
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0001501	skeletal system development	TAS		10448861
GO:0030104	water homeostasis	IEA		-
GO:0007265	Ras protein signal transduction	TAS		10848592
GO:0006260	DNA replication	TAS		10766744
GO:0009887	organ morphogenesis	IEA		-
GO:0007165	signal transduction	TAS		10448861
GO:0048468	cell development	IEA		-
GO:0007517	muscle development	TAS		10448861
GO:0007605	sensory perception of sound	IEA		-
GO:0009441	glycolate metabolic process	TAS		10448861
GO:0048015	phosphoinositide-mediated signaling	IDA		7692086
GO:0006928	cell motion	TAS		10766744
GO:0006916	anti-apoptosis	IDA		16942485
GO:0006916	anti-apoptosis	IEA		-
GO:0014065	phosphoinositide 3-kinase cascade	IDA		7688386
GO:0042523	positive regulation of tyrosine phosphorylation of Stat5 protein	IDA		9722506
GO:0033143	regulation of steroid hormone receptor signaling pathway	IDA		10459853
GO:0014834	satellite cell maintenance involved in skeletal muscle regeneration	IDA		17531227
GO:0014896	muscle hypertrophy	IMP		10191278
GO:0014904	myotube cell development	IDA		17531227
GO:0014911	positive regulation of smooth muscle cell migration	IDA		10766744
GO:0021940	positive regulation of granule cell precursor proliferation	IEA		-
GO:0043193	positive regulation of gene-specific transcription	IDA		9722506
GO:0048754	branching morphogenesis of a tube	IEA		-
GO:0051246	regulation of protein metabolic process	IEA		-
GO:0030879	mammary gland development	IEA		-
GO:0034392	negative regulation of smooth muscle cell apoptosis	IDA		16942485
GO:0035264	multicellular organism growth	IEA		-
GO:0045740	positive regulation of DNA replication	IDA		7688386 \|9722506
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0045840	positive regulation of mitosis	IDA		7188854
GO:0048146	positive regulation of fibroblast proliferation	IDA		7188854
GO:0050650	chondroitin sulfate proteoglycan biosynthetic process	IEA		-
GO:0050679	positive regulation of epithelial cell proliferation	IDA		7188854
GO:0045821	positive regulation of glycolysis	IDA		7688386
GO:0043568	positive regulation of insulin-like growth factor receptor signaling pathway	IDA		7688386 \|10766744
GO:0046579	positive regulation of Ras protein signal transduction	IDA		9722506
GO:0048661	positive regulation of smooth muscle cell proliferation	IDA		10766744 \|16942485
GO:0045445	myoblast differentiation	IDA		17531227
GO:0051450	myoblast proliferation	IDA		17531227
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	EXP		2752154
GO:0005576	extracellular region	IEA		-
GO:0005576	extracellular region	NAS		14718574
GO:0005615	extracellular space	IEA		-
GO:0016942	insulin-like growth factor binding protein complex	IC		10766744
GO:0031093	platelet alpha granule lumen	EXP		2752154

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
IDE	FLJ35968 \| INSULYSIN	insulin-degrading enzyme	Reconstituted Complex	BioGRID	1733942
IGF1R	CD221 \| IGFIR \| JTK13 \| MGC142170 \| MGC142172 \| MGC18216	insulin-like growth factor 1 receptor	IGF-I interacts with IGF-IR. This interaction was modeled on a demonstrated interaction between IGF-I from an unspecified species and human IGF-IR.	BIND	15604363
IGF1R	CD221 \| IGFIR \| JTK13 \| MGC142170 \| MGC142172 \| MGC18216	insulin-like growth factor 1 receptor	-	HPRD,BioGRID	1852007
IGFALS	ALS	insulin-like growth factor binding protein, acid labile subunit	-	HPRD,BioGRID	9497324 \|10823924
IGFBP1	AFBP \| IBP1 \| IGF-BP25 \| PP12 \| hIGFBP-1	insulin-like growth factor binding protein 1	-	HPRD,BioGRID	10350456
IGFBP1	AFBP \| IBP1 \| IGF-BP25 \| PP12 \| hIGFBP-1	insulin-like growth factor binding protein 1	IGF-I interacts with IGFBP-1.	BIND	10407151
IGFBP2	IBP2 \| IGF-BP53	insulin-like growth factor binding protein 2, 36kDa	IGF-I interacts with IGFBP-2.	BIND	10407151
IGFBP2	IBP2 \| IGF-BP53	insulin-like growth factor binding protein 2, 36kDa	-	HPRD,BioGRID	11063745
IGFBP3	BP-53 \| IBP3	insulin-like growth factor binding protein 3	-	HPRD,BioGRID	11600567
IGFBP3	BP-53 \| IBP3	insulin-like growth factor binding protein 3	IGF-I interacts with IGFBP-3.	BIND	10407151
IGFBP4	BP-4 \| HT29-IGFBP \| IBP4 \| IGFBP-4	insulin-like growth factor binding protein 4	-	HPRD,BioGRID	9722589
IGFBP4	BP-4 \| HT29-IGFBP \| IBP4 \| IGFBP-4	insulin-like growth factor binding protein 4	IGF-I interacts with IGFBP-4.	BIND	10407151
IGFBP5	IBP5	insulin-like growth factor binding protein 5	IGF-I interacts with IGFBP-5.	BIND	10407151
IGFBP5	IBP5	insulin-like growth factor binding protein 5	-	HPRD,BioGRID	9497324
IGFBP6	IBP6	insulin-like growth factor binding protein 6	IGF-I interacts with IGFBP-6.	BIND	10407151
IGFBP6	IBP6	insulin-like growth factor binding protein 6	-	HPRD	7683646
IGFBP7	FSTL2 \| IGFBP-7 \| IGFBP-7v \| IGFBPRP1 \| MAC25 \| PSF	insulin-like growth factor binding protein 7	-	HPRD,BioGRID	8939990
IGSF1	IGCD1 \| IGDC1 \| INHBP \| KIAA0364 \| MGC75490 \| PGSF2	immunoglobulin superfamily, member 1	-	HPRD,BioGRID	11344214
NOV	CCN3 \| IGFBP9	nephroblastoma overexpressed gene	-	HPRD,BioGRID	10084601
TF	DKFZp781D0156 \| PRO1557 \| PRO2086	transferrin	Reconstituted Complex	BioGRID	11749962

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG OOCYTE MEIOSIS	114	79	All SZGR 2.0 genes in this pathway
KEGG P53 SIGNALING PATHWAY	69	45	All SZGR 2.0 genes in this pathway
KEGG MTOR SIGNALING PATHWAY	52	40	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG LONG TERM DEPRESSION	70	53	All SZGR 2.0 genes in this pathway
KEGG PROGESTERONE MEDIATED OOCYTE MATURATION	86	59	All SZGR 2.0 genes in this pathway
KEGG ALDOSTERONE REGULATED SODIUM REABSORPTION	42	29	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG GLIOMA	65	56	All SZGR 2.0 genes in this pathway
KEGG PROSTATE CANCER	89	75	All SZGR 2.0 genes in this pathway
KEGG MELANOMA	71	57	All SZGR 2.0 genes in this pathway
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM	85	65	All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY	92	68	All SZGR 2.0 genes in this pathway
BIOCARTA HDAC PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA ERYTH PATHWAY	15	11	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1 PATHWAY	21	16	All SZGR 2.0 genes in this pathway
BIOCARTA NFAT PATHWAY	56	45	All SZGR 2.0 genes in this pathway
BIOCARTA BAD PATHWAY	26	23	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1MTOR PATHWAY	20	14	All SZGR 2.0 genes in this pathway
BIOCARTA LONGEVITY PATHWAY	15	13	All SZGR 2.0 genes in this pathway
SIG PIP3 SIGNALING IN CARDIAC MYOCTES	67	54	All SZGR 2.0 genes in this pathway
PID ER NONGENOMIC PATHWAY	41	35	All SZGR 2.0 genes in this pathway
PID SHP2 PATHWAY	58	46	All SZGR 2.0 genes in this pathway
PID IGF1 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID CERAMIDE PATHWAY	48	37	All SZGR 2.0 genes in this pathway
PID AVB3 INTEGRIN PATHWAY	75	53	All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY	42	34	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST LOBULAR CARCINOMA VS DUCTAL NORMAL UP	69	38	All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA DN	62	41	All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN	291	176	All SZGR 2.0 genes in this pathway
PACHER TARGETS OF IGF1 AND IGF2 UP	35	27	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
BARRIER CANCER RELAPSE NORMAL SAMPLE UP	32	21	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
BUSA SAM68 TARGETS DN	6	5	All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 UP	30	24	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM4	261	153	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN 2FC DN	21	13	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
GALIE TUMOR ANGIOGENESIS	8	7	All SZGR 2.0 genes in this pathway
BERTUCCI INVASIVE CARCINOMA DUCTAL VS LOBULAR DN	46	34	All SZGR 2.0 genes in this pathway
GARCIA TARGETS OF FLI1 AND DAX1 DN	176	104	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT DN	45	33	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER F	54	32	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPLICATION GENES	147	87	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC TGFA DN	65	44	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC E2F1 DN	64	38	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER MYC DN	63	40	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER E2F1 DN	64	42	All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION	475	313	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS DN	65	36	All SZGR 2.0 genes in this pathway
IGLESIAS E2F TARGETS DN	16	11	All SZGR 2.0 genes in this pathway
KUMAR TARGETS OF MLL AF9 FUSION	405	264	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
LIU SMARCA4 TARGETS	64	39	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 0HR	63	48	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP	113	71	All SZGR 2.0 genes in this pathway
BACOLOD RESISTANCE TO ALKYLATING AGENTS UP	26	17	All SZGR 2.0 genes in this pathway
GERHOLD ADIPOGENESIS UP	49	40	All SZGR 2.0 genes in this pathway
WENG POR TARGETS LIVER DN	20	11	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO OR UV	63	44	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN	195	135	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS UP	170	107	All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP	430	288	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN LUNG DN	37	22	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL A UP	84	52	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP	476	285	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
IZADPANAH STEM CELL ADIPOSE VS BONE DN	108	68	All SZGR 2.0 genes in this pathway
MATZUK EARLY ANTRAL FOLLICLE	13	11	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP	260	174	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH DN	31	25	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP	165	118	All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN	138	92	All SZGR 2.0 genes in this pathway
WU SILENCED BY METHYLATION IN BLADDER CANCER	55	42	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
LIU VAV3 PROSTATE CARCINOGENESIS UP	89	61	All SZGR 2.0 genes in this pathway
ZHAN LATE DIFFERENTIATION GENES UP	33	24	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL DN	113	76	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER STEM CELL UP	47	38	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 ICP WITH H3K4ME3 AND H3K27ME3	34	21	All SZGR 2.0 genes in this pathway
NAKAYAMA FGF2 TARGETS	29	17	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3	266	180	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN	267	160	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES DN	210	141	All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA2 DN	80	51	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3	137	85	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11	103	68	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway
TERAO AOX4 TARGETS SKIN DN	27	15	All SZGR 2.0 genes in this pathway
IKEDA MIR1 TARGETS UP	53	39	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS UP	169	105	All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS DN	157	105	All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP	364	236	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR DN	244	157	All SZGR 2.0 genes in this pathway
DURAND STROMA S UP	297	194	All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS	344	197	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	151	158	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-142-5p	4421	4428	1A,m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-150	3590	3597	1A,m8	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-18	181	187	m8	hsa-miR-18a	UAAGGUGCAUCUAGUGCAGAUA
miR-18	181	187	m8	hsa-miR-18b	UAAGGUGCAUCUAGUGCAGUUA
miR-186	3676	3682	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-186	3676	3682	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-19	178	184	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	178	184	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-26	3689	3695	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	3689	3695	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-27	4376	4382	1A	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	4376	4382	1A	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-29	3664	3671	1A,m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
				hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-30-3p	3278	3284	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	3278	3284	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-320	640	646	1A	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-409-3p	150	156	m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-486	855	861	1A	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG
miR-495	916	923	1A,m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-496	832	838	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-496	832	838	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: IGF1