Gene Page: LDHA
Summary ?
| GeneID | 3939 |
| Symbol | LDHA |
| Synonyms | GSD11|HEL-S-133P|LDHM|PIG19 |
| Description | lactate dehydrogenase A |
| Reference | MIM:150000|HGNC:HGNC:6535|Ensembl:ENSG00000134333|HPRD:01025|Vega:OTTHUMG00000167721 |
| Gene type | protein-coding |
| Map location | 11p15.4 |
| Pascal p-value | 0.797 |
| Sherlock p-value | 0.02 |
| Fetal beta | -1.355 |
| eGene | Myers' cis & trans |
| Support | CELL METABOLISM G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_clathrin G2Cdb.human_Synaptosome G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Expression | Meta-analysis of gene expression | P value: 1.65 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs10994209 | chr10 | 61877705 | LDHA | 3939 | 0.04 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AC079061.1 | 0.88 | 0.85 |
| RNF19A | 0.88 | 0.85 |
| PTPRK | 0.86 | 0.81 |
| CHN2 | 0.86 | 0.87 |
| RP11-791G16.2 | 0.84 | 0.84 |
| DOCK9 | 0.84 | 0.84 |
| MEF2C | 0.83 | 0.79 |
| FAM81A | 0.82 | 0.81 |
| MARCH1 | 0.82 | 0.81 |
| RHOBTB1 | 0.82 | 0.81 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.62 | -0.64 |
| AF347015.31 | -0.62 | -0.64 |
| AF347015.2 | -0.61 | -0.66 |
| HSD17B14 | -0.61 | -0.67 |
| AF347015.8 | -0.60 | -0.63 |
| MT-CYB | -0.60 | -0.61 |
| AF347015.33 | -0.59 | -0.60 |
| ACSF2 | -0.59 | -0.68 |
| AF347015.26 | -0.58 | -0.60 |
| AF347015.27 | -0.58 | -0.59 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 15231747 |17220478 | |
| GO:0004459 | L-lactate dehydrogenase activity | TAS | 2334430 | |
| GO:0016491 | oxidoreductase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0019642 | anaerobic glycolysis | IEA | - | |
| GO:0044262 | cellular carbohydrate metabolic process | IEA | - | |
| GO:0055114 | oxidation reduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | TAS | 2434947 | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCOLYSIS GLUCONEOGENESIS | 62 | 41 | All SZGR 2.0 genes in this pathway |
| KEGG CYSTEINE AND METHIONINE METABOLISM | 34 | 24 | All SZGR 2.0 genes in this pathway |
| KEGG PYRUVATE METABOLISM | 40 | 26 | All SZGR 2.0 genes in this pathway |
| KEGG PROPANOATE METABOLISM | 33 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA HIF PATHWAY | 15 | 12 | All SZGR 2.0 genes in this pathway |
| BIOCARTA SARS PATHWAY | 10 | 5 | All SZGR 2.0 genes in this pathway |
| PID MYC ACTIV PATHWAY | 79 | 62 | All SZGR 2.0 genes in this pathway |
| PID HIF1 TFPATHWAY | 66 | 52 | All SZGR 2.0 genes in this pathway |
| REACTOME PYRUVATE METABOLISM AND CITRIC ACID TCA CYCLE | 48 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME TCA CYCLE AND RESPIRATORY ELECTRON TRANSPORT | 141 | 85 | All SZGR 2.0 genes in this pathway |
| REACTOME PYRUVATE METABOLISM | 19 | 14 | All SZGR 2.0 genes in this pathway |
| WINTER HYPOXIA UP | 92 | 57 | All SZGR 2.0 genes in this pathway |
| LIU SOX4 TARGETS DN | 309 | 191 | All SZGR 2.0 genes in this pathway |
| CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
| HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| RHEIN ALL GLUCOCORTICOID THERAPY DN | 362 | 238 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN | 77 | 46 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN DN | 172 | 112 | All SZGR 2.0 genes in this pathway |
| OUELLET OVARIAN CANCER INVASIVE VS LMP UP | 117 | 85 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
| DARWICHE SKIN TUMOR PROMOTER UP | 142 | 96 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK HIGH UP | 147 | 101 | All SZGR 2.0 genes in this pathway |
| DARWICHE SQUAMOUS CELL CARCINOMA UP | 146 | 104 | All SZGR 2.0 genes in this pathway |
| APPIERTO RESPONSE TO FENRETINIDE DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
| LI AMPLIFIED IN LUNG CANCER | 178 | 108 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER MYC TARGETS AND SERUM RESPONSE DN | 47 | 34 | All SZGR 2.0 genes in this pathway |
| TERAMOTO OPN TARGETS CLUSTER 4 | 13 | 8 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP | 176 | 111 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| PUJANA CHEK2 PCC NETWORK | 779 | 480 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| MENSSEN MYC TARGETS | 53 | 35 | All SZGR 2.0 genes in this pathway |
| PENG LEUCINE DEPRIVATION DN | 187 | 122 | All SZGR 2.0 genes in this pathway |
| POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC UP | 62 | 38 | All SZGR 2.0 genes in this pathway |
| ZUCCHI METASTASIS UP | 43 | 24 | All SZGR 2.0 genes in this pathway |
| SCHUHMACHER MYC TARGETS UP | 80 | 57 | All SZGR 2.0 genes in this pathway |
| SHIPP DLBCL VS FOLLICULAR LYMPHOMA UP | 45 | 30 | All SZGR 2.0 genes in this pathway |
| PENG GLUTAMINE DEPRIVATION DN | 337 | 230 | All SZGR 2.0 genes in this pathway |
| KIM HYPOXIA | 25 | 21 | All SZGR 2.0 genes in this pathway |
| KAAB FAILED HEART ATRIUM DN | 141 | 99 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| RHODES CANCER META SIGNATURE | 64 | 47 | All SZGR 2.0 genes in this pathway |
| HARRIS HYPOXIA | 81 | 64 | All SZGR 2.0 genes in this pathway |
| BURTON ADIPOGENESIS 4 | 48 | 32 | All SZGR 2.0 genes in this pathway |
| SEMENZA HIF1 TARGETS | 36 | 32 | All SZGR 2.0 genes in this pathway |
| KAAB FAILED HEART VENTRICLE DN | 41 | 28 | All SZGR 2.0 genes in this pathway |
| GERHOLD ADIPOGENESIS UP | 49 | 40 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
| KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
| ZHONG SECRETOME OF LUNG CANCER AND MACROPHAGE | 77 | 50 | All SZGR 2.0 genes in this pathway |
| ZHONG SECRETOME OF LUNG CANCER AND ENDOTHELIUM | 66 | 47 | All SZGR 2.0 genes in this pathway |
| ZHONG SECRETOME OF LUNG CANCER AND FIBROBLAST | 132 | 93 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS UP | 170 | 107 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| GRADE COLON AND RECTAL CANCER UP | 285 | 167 | All SZGR 2.0 genes in this pathway |
| LABBE TARGETS OF TGFB1 AND WNT3A DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
| MALONEY RESPONSE TO 17AAG DN | 79 | 45 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
| WINTER HYPOXIA METAGENE | 242 | 168 | All SZGR 2.0 genes in this pathway |
| MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
| HUNSBERGER EXERCISE REGULATED GENES | 31 | 26 | All SZGR 2.0 genes in this pathway |
| NUTT GBM VS AO GLIOMA UP | 46 | 34 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
| HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE UP | 163 | 102 | All SZGR 2.0 genes in this pathway |
| SHAFFER IRF4 TARGETS IN MYELOMA VS MATURE B LYMPHOCYTE | 101 | 76 | All SZGR 2.0 genes in this pathway |
| SHAFFER IRF4 TARGETS IN ACTIVATED B LYMPHOCYTE | 81 | 66 | All SZGR 2.0 genes in this pathway |
| HSIAO HOUSEKEEPING GENES | 389 | 245 | All SZGR 2.0 genes in this pathway |
| FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD2 DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| DANG MYC TARGETS UP | 143 | 100 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 10 | 69 | 38 | All SZGR 2.0 genes in this pathway |
| MOOTHA GLUCONEOGENESIS | 32 | 23 | All SZGR 2.0 genes in this pathway |
| NOUSHMEHR GBM SILENCED BY METHYLATION | 50 | 32 | All SZGR 2.0 genes in this pathway |
| VANDESLUIS COMMD1 TARGETS GROUP 3 UP | 89 | 50 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 AND SATB1 UP | 87 | 52 | All SZGR 2.0 genes in this pathway |
| JUBAN TARGETS OF SPI1 AND FLI1 DN | 92 | 60 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-34/449 | 257 | 264 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.