SZGR2

Summary ?

GeneID	4772
Symbol	NFATC1
Synonyms	NF-ATC\|NF-ATc1.2\|NFAT2\|NFATc
Description	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Reference	MIM:600489\|HGNC:HGNC:7775\|Ensembl:ENSG00000131196\|HPRD:02729\|Vega:OTTHUMG00000132897
Gene type	protein-coding
Map location	18q23
Pascal p-value	0.432
Fetal beta	-0.692
DMG	1 (# studies)
eGene	Hippocampus

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Montano_2016	Genome-wide DNA methylation analysis	This dataset includes 172 replicated associations between CpGs with schizophrenia.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0161

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06784563	18	77284509	NFATC1	3.67E-4	-0.006	0.193	DMG:Montano_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GNG3	0.57	0.61
MANBAL	0.57	0.58
CDK5	0.56	0.61
MAP1LC3A	0.56	0.61
TCTA	0.55	0.60
CLTB	0.55	0.56
NELF	0.54	0.60
NAT5	0.54	0.55
METTL11A	0.53	0.53
MECR	0.53	0.59

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.18	-0.29	-0.13
CWF19L2	-0.29	-0.36
EIF5B	-0.29	-0.37
AC010300.1	-0.28	-0.26
AC005921.3	-0.27	-0.40
EDN1	-0.24	-0.22
ZRSR2	-0.24	-0.24
ANP32B	-0.24	-0.30
AC069281.3	-0.24	-0.22
RBMX2	-0.23	-0.26

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		9506523 \|10821850
GO:0005528	FK506 binding	TAS		8702849
GO:0016563	transcription activator activity	IDA		14749367
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IDA		14749367
GO:0006366	transcription from RNA polymerase II promoter	TAS		8702849
GO:0007242	intracellular signaling cascade	IDA		14749367
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	TAS		8202141

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG WNT SIGNALING PATHWAY	151	112	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG VEGF SIGNALING PATHWAY	76	53	All SZGR 2.0 genes in this pathway
KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY	137	92	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG B CELL RECEPTOR SIGNALING PATHWAY	75	56	All SZGR 2.0 genes in this pathway
BIOCARTA BCR PATHWAY	37	28	All SZGR 2.0 genes in this pathway
BIOCARTA HDAC PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA CALCINEURIN PATHWAY	21	17	All SZGR 2.0 genes in this pathway
BIOCARTA FCER1 PATHWAY	41	30	All SZGR 2.0 genes in this pathway
BIOCARTA FMLP PATHWAY	39	29	All SZGR 2.0 genes in this pathway
BIOCARTA GATA3 PATHWAY	16	15	All SZGR 2.0 genes in this pathway
BIOCARTA VIP PATHWAY	29	26	All SZGR 2.0 genes in this pathway
BIOCARTA NFAT PATHWAY	56	45	All SZGR 2.0 genes in this pathway
BIOCARTA MEF2D PATHWAY	23	16	All SZGR 2.0 genes in this pathway
BIOCARTA GPCR PATHWAY	37	31	All SZGR 2.0 genes in this pathway
BIOCARTA TCR PATHWAY	49	37	All SZGR 2.0 genes in this pathway
SIG BCR SIGNALING PATHWAY	46	38	All SZGR 2.0 genes in this pathway
PID BCR 5PATHWAY	65	50	All SZGR 2.0 genes in this pathway
PID NFAT TFPATHWAY	47	39	All SZGR 2.0 genes in this pathway
PID FRA PATHWAY	37	28	All SZGR 2.0 genes in this pathway
PID NFAT 3PATHWAY	54	47	All SZGR 2.0 genes in this pathway
PID REG GR PATHWAY	82	60	All SZGR 2.0 genes in this pathway
PID AP1 PATHWAY	70	60	All SZGR 2.0 genes in this pathway
PID TCR CALCIUM PATHWAY	29	23	All SZGR 2.0 genes in this pathway
PID CD8 TCR DOWNSTREAM PATHWAY	65	56	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN	406	230	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP	276	165	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP	341	197	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
TERAMOTO OPN TARGETS CLUSTER 7	19	16	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN	357	212	All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 3	28	23	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS DN	65	36	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY HNE AND TBH	60	42	All SZGR 2.0 genes in this pathway
SAFFORD T LYMPHOCYTE ANERGY	87	54	All SZGR 2.0 genes in this pathway
VILIMAS NOTCH1 TARGETS UP	52	41	All SZGR 2.0 genes in this pathway
ZAIDI OSTEOBLAST TRANSCRIPTION FACTORS	14	12	All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN	238	145	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS DN	54	38	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP	134	85	All SZGR 2.0 genes in this pathway
FUKUSHIMA TNFSF11 TARGETS	16	14	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP	199	143	All SZGR 2.0 genes in this pathway
HOLLEMAN VINCRISTINE RESISTANCE B ALL UP	38	22	All SZGR 2.0 genes in this pathway
DURAND STROMA S UP	297	194	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	354	360	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	354	360	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	353	360	1A,m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-145	346	352	1A	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NFATC1