Gene Page: NRCAM
Summary ?
| GeneID | 4897 |
| Symbol | NRCAM |
| Synonyms | - |
| Description | neuronal cell adhesion molecule |
| Reference | MIM:601581|HGNC:HGNC:7994|Ensembl:ENSG00000091129|HPRD:07207|Vega:OTTHUMG00000154973 |
| Gene type | protein-coding |
| Map location | 7q31 |
| Pascal p-value | 0.008 |
| Sherlock p-value | 0.272 |
| Fetal beta | 1.079 |
| eGene | Meta |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 8 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| CNOT1 | 0.96 | 0.96 |
| C2CD3 | 0.94 | 0.95 |
| KDM3B | 0.94 | 0.95 |
| IPO9 | 0.94 | 0.94 |
| PRPF8 | 0.94 | 0.96 |
| DHX8 | 0.94 | 0.96 |
| CRKRS | 0.94 | 0.95 |
| SNRNP200 | 0.94 | 0.94 |
| LIG3 | 0.94 | 0.95 |
| MSL2 | 0.94 | 0.96 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.75 | -0.85 |
| MT-CO2 | -0.74 | -0.85 |
| IFI27 | -0.72 | -0.82 |
| AF347015.21 | -0.72 | -0.89 |
| AF347015.27 | -0.71 | -0.82 |
| FXYD1 | -0.71 | -0.82 |
| AF347015.8 | -0.70 | -0.83 |
| AF347015.33 | -0.70 | -0.79 |
| HIGD1B | -0.69 | -0.82 |
| MT-CYB | -0.69 | -0.80 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | NAS | 11483367 | |
| GO:0030506 | ankyrin binding | IDA | 14602817 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0045162 | clustering of voltage-gated sodium channels | IDA | neuron, axon (GO term level: 12) | 14602817 |
| GO:0007417 | central nervous system development | NAS | Brain (GO term level: 6) | 8812479 |
| GO:0007416 | synaptogenesis | TAS | Synap (GO term level: 6) | 8812479 |
| GO:0007413 | axonal fasciculation | NAS | neuron, axon (GO term level: 13) | 8812479 |
| GO:0001764 | neuron migration | NAS | neuron (GO term level: 8) | 11483367 |
| GO:0030516 | regulation of axon extension | NAS | axon (GO term level: 14) | 8812479 |
| GO:0045666 | positive regulation of neuron differentiation | NAS | neuron (GO term level: 10) | 8812479 |
| GO:0016337 | cell-cell adhesion | NAS | 8812479 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0043005 | neuron projection | NAS | neuron, axon, neurite, dendrite (GO term level: 5) | 8812479 |
| GO:0009897 | external side of plasma membrane | NAS | 8812479 | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | NAS | 8812479 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CELL ADHESION MOLECULES CAMS | 134 | 93 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
| REACTOME INTERACTION BETWEEN L1 AND ANKYRINS | 23 | 19 | All SZGR 2.0 genes in this pathway |
| PARENT MTOR SIGNALING DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP | 59 | 38 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
| DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION UP | 64 | 37 | All SZGR 2.0 genes in this pathway |
| JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP | 185 | 126 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION ERYTHROCYTE UP | 157 | 104 | All SZGR 2.0 genes in this pathway |
| TONKS TARGETS OF RUNX1 RUNX1T1 FUSION SUSTAINDED IN ERYTHROCYTE UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
| ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
| ODONNELL TARGETS OF MYC AND TFRC UP | 83 | 50 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| CHEBOTAEV GR TARGETS DN | 120 | 73 | All SZGR 2.0 genes in this pathway |
| EBAUER TARGETS OF PAX3 FOXO1 FUSION DN | 48 | 31 | All SZGR 2.0 genes in this pathway |
| TERAMOTO OPN TARGETS CLUSTER 8 | 8 | 7 | All SZGR 2.0 genes in this pathway |
| WEINMANN ADAPTATION TO HYPOXIA DN | 41 | 33 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| RICKMAN HEAD AND NECK CANCER A | 100 | 63 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| KANG IMMORTALIZED BY TERT UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
| PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
| PETROVA PROX1 TARGETS DN | 64 | 38 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
| XU GH1 AUTOCRINE TARGETS DN | 142 | 94 | All SZGR 2.0 genes in this pathway |
| MAHAJAN RESPONSE TO IL1A UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| RIGGINS TAMOXIFEN RESISTANCE DN | 220 | 147 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE BY UV | 62 | 43 | All SZGR 2.0 genes in this pathway |
| KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
| COATES MACROPHAGE M1 VS M2 UP | 81 | 52 | All SZGR 2.0 genes in this pathway |
| LEE METASTASIS AND ALTERNATIVE SPLICING UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS UP | 170 | 107 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
| HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
| GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
| BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE | 151 | 86 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124/506 | 833 | 839 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-153 | 1257 | 1263 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-182 | 1457 | 1463 | m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-191 | 408 | 414 | m8 | hsa-miR-191brain | CAACGGAAUCCCAAAAGCAGCU |
| miR-218 | 1963 | 1969 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-30-3p | 1717 | 1723 | m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
| hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
| miR-431 | 819 | 826 | 1A,m8 | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| miR-448 | 1257 | 1263 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-505 | 1530 | 1536 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
| miR-539 | 1472 | 1478 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.