SZGR2

Summary ?

GeneID	5055
Symbol	SERPINB2
Synonyms	HsT1201\|PAI\|PAI-2\|PAI2\|PLANH2
Description	serpin peptidase inhibitor, clade B (ovalbumin), member 2
Reference	MIM:173390\|HGNC:HGNC:8584\|Ensembl:ENSG00000197632\|HPRD:01420\|Vega:OTTHUMG00000060592
Gene type	protein-coding
Map location	18q21.3
Pascal p-value	0.644
Fetal beta	-1.063
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07871472	18	61567853	SERPINB2	5.483E-4	0.365	0.049	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
XPR1	0.93	0.97
CAPRIN1	0.93	0.97
CEP170	0.93	0.97
KDM5B	0.93	0.97
PPP2R3A	0.93	0.92
SPAST	0.92	0.96
SEMA3A	0.92	0.95
KIDINS220	0.92	0.96
STT3B	0.92	0.95
PRRC1	0.92	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SERPINB6	-0.65	-0.77
C5orf53	-0.65	-0.79
AIFM3	-0.65	-0.82
HLA-F	-0.64	-0.81
TNFSF12	-0.64	-0.67
HEPN1	-0.64	-0.80
TSC22D4	-0.64	-0.85
PTH1R	-0.63	-0.77
HSD17B14	-0.63	-0.82
LHPP	-0.63	-0.63

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004252	serine-type endopeptidase activity	IEA	glutamate (GO term level: 7)	-
GO:0004867	serine-type endopeptidase inhibitor activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006916	anti-apoptosis	TAS		7499264
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA FIBRINOLYSIS PATHWAY	12	8	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
CORRE MULTIPLE MYELOMA UP	74	45	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
SMIRNOV CIRCULATING ENDOTHELIOCYTES IN CANCER UP	158	103	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP	233	161	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC UP	185	126	All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP	457	269	All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP	238	144	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL DN	226	132	All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL QUIESCENT UP	87	45	All SZGR 2.0 genes in this pathway
GRAHAM CML QUIESCENT VS NORMAL DIVIDING UP	57	33	All SZGR 2.0 genes in this pathway
GRAHAM CML DIVIDING VS NORMAL QUIESCENT UP	181	101	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS F DN	33	24	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD DN	84	63	All SZGR 2.0 genes in this pathway
APPIERTO RESPONSE TO FENRETINIDE DN	51	35	All SZGR 2.0 genes in this pathway
DACOSTA ERCC3 ALLELE XPCS VS TTD DN	36	27	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
FALVELLA SMOKERS WITH LUNG CANCER	80	52	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP	769	437	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC DN	31	23	All SZGR 2.0 genes in this pathway
CAFFAREL RESPONSE TO THC 24HR 5 DN	59	35	All SZGR 2.0 genes in this pathway
FRIDMAN SENESCENCE UP	77	60	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 120 MCF10A	43	28	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 240 MCF10A	57	36	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 1 DN	169	102	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 3 DN	59	32	All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 UP	51	30	All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION DN	44	30	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
GERY CEBP TARGETS	126	90	All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP	183	111	All SZGR 2.0 genes in this pathway
KANG IMMORTALIZED BY TERT UP	89	61	All SZGR 2.0 genes in this pathway
HANSON HRAS SIGNALING VIA NFKB	22	14	All SZGR 2.0 genes in this pathway
LIANG SILENCED BY METHYLATION 2	53	34	All SZGR 2.0 genes in this pathway
LY AGING PREMATURE DN	30	17	All SZGR 2.0 genes in this pathway
ABE VEGFA TARGETS 2HR	34	21	All SZGR 2.0 genes in this pathway
CHANG IMMORTALIZED BY HPV31 DN	65	45	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR DN	101	70	All SZGR 2.0 genes in this pathway
NIELSEN LIPOSARCOMA UP	18	13	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN	245	144	All SZGR 2.0 genes in this pathway
MCCLUNG COCAIN REWARD 4WK	75	47	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C1	72	45	All SZGR 2.0 genes in this pathway
LY AGING MIDDLE UP	14	11	All SZGR 2.0 genes in this pathway
LY AGING OLD DN	56	35	All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A UP	81	52	All SZGR 2.0 genes in this pathway
JOSEPH RESPONSE TO SODIUM BUTYRATE UP	31	21	All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES UP	253	147	All SZGR 2.0 genes in this pathway
SU PLACENTA	30	18	All SZGR 2.0 genes in this pathway
BILD HRAS ONCOGENIC SIGNATURE	261	166	All SZGR 2.0 genes in this pathway
BILD SRC ONCOGENIC SIGNATURE	62	38	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO OR UV	63	44	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN	195	135	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
SARRIO EPITHELIAL MESENCHYMAL TRANSITION UP	180	114	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP	295	149	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE	242	168	All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE DN	264	159	All SZGR 2.0 genes in this pathway
PARK APL PATHOGENESIS DN	50	35	All SZGR 2.0 genes in this pathway
RUIZ TNC TARGETS DN	142	79	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS KERATINOCYTE UP	91	63	All SZGR 2.0 genes in this pathway
HINATA NFKB TARGETS FIBROBLAST UP	84	60	All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE UP	26	19	All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS	108	68	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL UP	73	49	All SZGR 2.0 genes in this pathway
DASU IL6 SIGNALING UP	59	44	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B	549	316	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION TOP20 UP	20	14	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP	271	165	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
KATSANOU ELAVL1 TARGETS DN	148	88	All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP	364	236	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 PARTIAL	160	106	All SZGR 2.0 genes in this pathway
BOSCO EPITHELIAL DIFFERENTIATION MODULE	69	31	All SZGR 2.0 genes in this pathway
GHANDHI DIRECT IRRADIATION UP	110	68	All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION UP	86	54	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway
NABA ECM REGULATORS	238	125	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-182	70	77	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-96	71	77	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SERPINB2