Gene Page: PLEC
Summary ?
GeneID | 5339 |
Symbol | PLEC |
Synonyms | EBS1|EBSMD|EBSND|EBSO|EBSOG|EBSPA|HD1|LGMD2Q|PCN|PLEC1|PLEC1b|PLTN |
Description | plectin |
Reference | MIM:601282|HGNC:HGNC:9069|Ensembl:ENSG00000178209|HPRD:03180|Vega:OTTHUMG00000165291 |
Gene type | protein-coding |
Map location | 8q24 |
Pascal p-value | 0.373 |
Sherlock p-value | 0.035 |
Fetal beta | -0.883 |
eGene | Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hypothalamus Myers' cis & trans Meta |
Support | STRUCTURAL PLASTICITY G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6694099 | chr1 | 19582337 | PLEC | 5339 | 0.14 | trans | ||
rs1063986 | chr1 | 19586570 | PLEC | 5339 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZNF672 | 0.93 | 0.89 |
FSCN1 | 0.92 | 0.90 |
ZC3H3 | 0.92 | 0.92 |
ZNF574 | 0.91 | 0.91 |
VARS | 0.91 | 0.87 |
IRF2BP2 | 0.90 | 0.88 |
SRC | 0.90 | 0.89 |
RBM14 | 0.90 | 0.92 |
ZNF319 | 0.90 | 0.89 |
FIZ1 | 0.89 | 0.90 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.66 | -0.74 |
AF347015.31 | -0.65 | -0.80 |
AF347015.27 | -0.64 | -0.81 |
MT-CO2 | -0.63 | -0.80 |
S100B | -0.63 | -0.77 |
AF347015.21 | -0.62 | -0.86 |
AF347015.8 | -0.61 | -0.79 |
AF347015.33 | -0.61 | -0.77 |
COPZ2 | -0.60 | -0.71 |
MT-CYB | -0.59 | -0.77 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003779 | actin binding | IEA | - | |
GO:0008307 | structural constituent of muscle | TAS | 8696340 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005886 | plasma membrane | NAS | 8633055 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME APOPTOTIC CLEAVAGE OF CELLULAR PROTEINS | 40 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME CELL CELL COMMUNICATION | 120 | 77 | All SZGR 2.0 genes in this pathway |
REACTOME CASPASE MEDIATED CLEAVAGE OF CYTOSKELETAL PROTEINS | 13 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME CELL JUNCTION ORGANIZATION | 78 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOSIS | 148 | 94 | All SZGR 2.0 genes in this pathway |
REACTOME APOPTOTIC EXECUTION PHASE | 54 | 37 | All SZGR 2.0 genes in this pathway |
WILCOX RESPONSE TO PROGESTERONE DN | 66 | 44 | All SZGR 2.0 genes in this pathway |
PUIFFE INVASION INHIBITED BY ASCITES UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS UP | 114 | 66 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS C UP | 170 | 114 | All SZGR 2.0 genes in this pathway |
WANG BARRETTS ESOPHAGUS UP | 51 | 27 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE NORMAL DN | 33 | 27 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE IMMORTALIZED DN | 31 | 26 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 UP | 209 | 139 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A DN | 103 | 71 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
PETRETTO HEART MASS QTL CIS UP | 28 | 15 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 8Q23 Q24 AMPLICON | 157 | 87 | All SZGR 2.0 genes in this pathway |
POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC UP | 62 | 38 | All SZGR 2.0 genes in this pathway |
RADAEVA RESPONSE TO IFNA1 DN | 10 | 5 | All SZGR 2.0 genes in this pathway |
FERRANDO T ALL WITH MLL ENL FUSION UP | 87 | 67 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
CROMER METASTASIS DN | 81 | 58 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR DN | 86 | 62 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
JI RESPONSE TO FSH DN | 58 | 43 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
KAAB FAILED HEART ATRIUM UP | 38 | 30 | All SZGR 2.0 genes in this pathway |
DASU IL6 SIGNALING SCAR UP | 30 | 21 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
NIELSEN LEIOMYOSARCOMA UP | 18 | 10 | All SZGR 2.0 genes in this pathway |
BILD MYC ONCOGENIC SIGNATURE | 206 | 117 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
WU ALZHEIMER DISEASE DN | 19 | 12 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
DASU IL6 SIGNALING UP | 59 | 44 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
WIERENGA PML INTERACTOME | 42 | 23 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
ALFANO MYC TARGETS | 239 | 156 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 602 | 608 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA | ||||
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-137 | 1009 | 1015 | m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-485-5p | 581 | 587 | m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
miR-7 | 84 | 90 | m8 | hsa-miR-7SZ | UGGAAGACUAGUGAUUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.