Gene Page: PNOC
Summary ?
GeneID | 5368 |
Symbol | PNOC |
Synonyms | N/OFQ|NOP|OFQ|PPNOC|ppN/OFQ |
Description | prepronociceptin |
Reference | MIM:601459|HGNC:HGNC:9163|Ensembl:ENSG00000168081|HPRD:03268|Vega:OTTHUMG00000102125 |
Gene type | protein-coding |
Map location | 8p21 |
Pascal p-value | 0.495 |
Fetal beta | -1.046 |
eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005184 | neuropeptide hormone activity | TAS | axon, Synap, Brain, Neurotransmitter (GO term level: 6) | 10419552 |
GO:0001515 | opioid peptide activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | IEA | neuron, Synap, Neurotransmitter (GO term level: 6) | - |
GO:0007218 | neuropeptide signaling pathway | IEA | Neurotransmitter (GO term level: 8) | - |
GO:0007165 | signal transduction | TAS | 9521323 | |
GO:0007600 | sensory perception | TAS | 9521323 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | TAS | 9521323 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME PEPTIDE LIGAND BINDING RECEPTORS | 188 | 108 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS | 305 | 177 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA I SIGNALLING EVENTS | 195 | 114 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA DN | 104 | 59 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
EBAUER TARGETS OF PAX3 FOXO1 FUSION UP | 207 | 128 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING VIA SMAD4 DN | 66 | 38 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT UP | 21 | 19 | All SZGR 2.0 genes in this pathway |
PENG LEUCINE DEPRIVATION UP | 142 | 93 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD2 UP | 45 | 32 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING DN | 68 | 44 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 VS CD2 DN | 52 | 35 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 10HR DN | 56 | 37 | All SZGR 2.0 genes in this pathway |
HEDENFALK BREAST CANCER BRACX UP | 20 | 14 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1B TARGETS | 92 | 68 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 ICP WITH H3K27ME3 | 74 | 46 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
BAKKER FOXO3 TARGETS DN | 187 | 109 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-183 | 366 | 372 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-34/449 | 363 | 370 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.