Gene Page: PCDH18
Summary ?
| GeneID | 54510 |
| Symbol | PCDH18 |
| Synonyms | PCDH68L |
| Description | protocadherin 18 |
| Reference | MIM:608287|HGNC:HGNC:14268|Ensembl:ENSG00000189184|HPRD:12205|Vega:OTTHUMG00000161348 |
| Gene type | protein-coding |
| Map location | 4q31 |
| Pascal p-value | 0.098 |
| Sherlock p-value | 0.531 |
| Fetal beta | 0.828 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Expression | Meta-analysis of gene expression | P value: 1.9 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs695809 | chr22 | 26278127 | PCDH18 | 54510 | 0.04 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005515 | protein binding | ISS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007420 | brain development | ISS | Brain (GO term level: 7) | - |
| GO:0007155 | cell adhesion | IEA | - | |
| GO:0007156 | homophilic cell adhesion | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
| ROVERSI GLIOMA COPY NUMBER UP | 100 | 75 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER SOX9 TARGETS IN PROSTATE DEVELOPMENT DN | 45 | 33 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB TARGETS | 74 | 41 | All SZGR 2.0 genes in this pathway |
| SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD1 VS CD2 UP | 66 | 47 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
| CHANDRAN METASTASIS DN | 306 | 191 | All SZGR 2.0 genes in this pathway |
| HOELZEL NF1 TARGETS DN | 115 | 73 | All SZGR 2.0 genes in this pathway |
| PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
| MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
| PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 138 | 144 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-144 | 137 | 144 | 1A,m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-182 | 85 | 92 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-26 | 969 | 976 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-380-5p | 318 | 324 | 1A | hsa-miR-380-5p | UGGUUGACCAUAGAACAUGCGC |
| hsa-miR-563 | AGGUUGACAUACGUUUCCC | ||||
| miR-493-5p | 152 | 158 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
| miR-495 | 1102 | 1108 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-96 | 86 | 92 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.