SZGR2

Summary ?

GeneID	54602
Symbol	NDFIP2
Synonyms	N4WBP5A
Description	Nedd4 family interacting protein 2
Reference	MIM:610041\|HGNC:HGNC:18537\|Ensembl:ENSG00000102471\|HPRD:17629\|Vega:OTTHUMG00000017136
Gene type	protein-coding
Map location	13q31.1
Pascal p-value	1.315E-4
Fetal beta	-1.004
DMG	1 (# studies)
eGene	Myers' cis & trans Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg14777817	13	80055594	NDFIP2	1.364E-4	-0.309	0.031	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs6548538	chr3	78015659	NDFIP2	54602	0.19	trans
rs7426755	chr3	78015728	NDFIP2	54602	0.14	trans
rs9813365	chr3	78045548	NDFIP2	54602	0.19	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	IMP		12761501
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043123	positive regulation of I-kappaB kinase/NF-kappaB cascade	IMP		12761501
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000139	Golgi membrane	IEA		-
GO:0005794	Golgi apparatus	IEA		-
GO:0005768	endosome	IEA		-
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-
GO:0010008	endosome membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN	391	222	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D DN	31	19	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP	176	115	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN	366	238	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS LATE PROGENITOR	544	307	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE DN	373	196	All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN	354	216	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN	540	340	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
BOSCO ALLERGEN INDUCED TH2 ASSOCIATED MODULE	151	86	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-135	159	165	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	159	165	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-145	1232	1239	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-19	202	209	1A,m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	202	209	1A,m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-221/222	265	271	1A	hsa-miR-221^brain	AGCUACAUUGUCUGCUGGGUUUC
miR-221/222	265	271	1A	hsa-miR-222^brain	AGCUACAUCUGGCUACUGGGUCUC
miR-23	35	42	1A,m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	35	42	1A,m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-26	243	249	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	243	249	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-323	35	41	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-410	472	479	1A,m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NDFIP2