SZGR2

Summary ?

GeneID	5587
Symbol	PRKD1
Synonyms	PKC-MU\|PKCM\|PKD\|PRKCM
Description	protein kinase D1
Reference	MIM:605435\|HGNC:HGNC:9407\|Ensembl:ENSG00000184304\|HPRD:05668\|Vega:OTTHUMG00000140203
Gene type	protein-coding
Map location	14q11
Pascal p-value	3.488E-6
Sherlock p-value	0.724
Fetal beta	0.716

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:PGC128	Genome-wide Association Study	A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnp	Genome-wide Association Study	GWAS
GSMA_I	Genome scan meta-analysis	Psr: 0.047

Section I. Genetics and epigenetics annotation

CV:PGC128

SNP ID	Chromosome	Position	Allele	P	Function	Gene	Up/Down Distance
rs2068012	chr14	30190316	TC	4.142E-8	intronic	PRKD1

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0004700	atypical protein kinase C activity	TAS		8119958
GO:0005515	protein binding	IPI		12893243
GO:0005524	ATP binding	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0019992	diacylglycerol binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006468	protein amino acid phosphorylation	TAS		8119958
GO:0007242	intracellular signaling cascade	IEA		-
GO:0008283	cell proliferation	TAS		8119958
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005829	cytosol	TAS		10856238
GO:0005886	plasma membrane	TAS		8119958 \|10856238
GO:0005887	integral to plasma membrane	TAS		8119958

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ADAP1	CENTA1 \| GCS1L \| p42IP4	ArfGAP with dual PH domains 1	-	HPRD,BioGRID	12893243
AKAP13	AKAP-Lbc \| BRX \| FLJ11952 \| FLJ43341 \| HA-3 \| Ht31 \| LBC \| PROTO-LB \| PROTO-LBC \| c-lbc	A kinase (PRKA) anchor protein 13	AKAP-Lbc interacts with PKD.	BIND	15383279
BTK	AGMX1 \| AT \| ATK \| BPK \| IMD1 \| MGC126261 \| MGC126262 \| PSCTK1 \| XLA	Bruton agammaglobulinemia tyrosine kinase	-	HPRD,BioGRID	10561498
C1QBP	GC1QBP \| HABP1 \| SF2p32 \| gC1Q-R \| gC1qR \| p32	complement component 1, q subcomponent binding protein	-	HPRD,BioGRID	10831594
GNB2L1	Gnb2-rs1 \| H12.3 \| HLC-7 \| PIG21 \| RACK1	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	PKC-mu interacts with RACK1.	BIND	11884618
HDAC5	FLJ90614 \| HD5 \| NY-CO-9	histone deacetylase 5	Affinity Capture-Western	BioGRID	15367659
IGF1R	CD221 \| IGFIR \| JTK13 \| MGC142170 \| MGC142172 \| MGC18216	insulin-like growth factor 1 receptor	PKC-mu interacts with IGF-IR.	BIND	11884618
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	11948398
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	Affinity Capture-Western	BioGRID	11948398
MAPK9	JNK-55 \| JNK2 \| JNK2A \| JNK2ALPHA \| JNK2B \| JNK2BETA \| PRKM9 \| SAPK \| p54a \| p54aSAPK	mitogen-activated protein kinase 9	Affinity Capture-Western	BioGRID	11948398
MT2A	MT2	metallothionein 2A	-	HPRD,BioGRID	14550308
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	-	HPRD,BioGRID	8885868
PLCG2	-	phospholipase C, gamma 2 (phosphatidylinositol-specific)	-	HPRD,BioGRID	8885868
PPP1R14A	CPI-17 \| CPI17 \| PPP1INL	protein phosphatase 1, regulatory (inhibitor) subunit 14A	-	HPRD	15003508
PRKCE	MGC125656 \| MGC125657 \| PKCE \| nPKC-epsilon	protein kinase C, epsilon	PRKCE (PKC-epsilon) phosphorylates PRKD1 (PKC-mu). This interaction was modeled on a demonstrated interaction between PRKCE from an unspecified species and human PRKD1.	BIND	12223477
PRKCH	MGC26269 \| MGC5363 \| PKC-L \| PKCL \| PRKCL \| nPKC-eta	protein kinase C, eta	PRKCH (PKC-eta) phosphorylates PRKD1 (PKC-mu). This interaction was modeled on a demonstrated interaction between PRKCH from an unspecified species and human PRKD1.	BIND	12223477
PRKD1	PKC-MU \| PKCM \| PKD \| PRKCM	protein kinase D1	PRKD1 (PKC-mu) autophosphorylates.	BIND	12223477
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	Affinity Capture-Western	BioGRID	8885868
USP15	KIAA0529 \| MGC131982 \| MGC149838 \| MGC74854 \| UNPH4	ubiquitin specific peptidase 15	PKD phosphorylates USP15.	BIND	16005295
YWHAQ	14-3-3 \| 1C5 \| HS1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide	Affinity Capture-Western Reconstituted Complex	BioGRID	10092600 \|10831594
YWHAZ	KCIP-1 \| MGC111427 \| MGC126532 \| MGC138156	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide	Reconstituted Complex	BioGRID	12893243

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ST GA13 PATHWAY	37	32	All SZGR 2.0 genes in this pathway
PID LYSOPHOSPHOLIPID PATHWAY	66	53	All SZGR 2.0 genes in this pathway
PID IGF1 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
REACTOME SPHINGOLIPID DE NOVO BIOSYNTHESIS	31	18	All SZGR 2.0 genes in this pathway
REACTOME PHOSPHOLIPID METABOLISM	198	112	All SZGR 2.0 genes in this pathway
REACTOME SPHINGOLIPID METABOLISM	69	40	All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS	478	302	All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP	567	375	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN	120	73	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS UP	344	180	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
NELSON RESPONSE TO ANDROGEN DN	19	14	All SZGR 2.0 genes in this pathway
YAGI AML SURVIVAL	129	87	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN	408	274	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 UP	295	149	All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP	425	298	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER BRCA1 DN	44	28	All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN	67	46	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS DN	87	66	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN DN	88	68	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN	115	73	All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE	227	151	All SZGR 2.0 genes in this pathway
DURAND STROMA S UP	297	194	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	618	624	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	618	624	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	27	33	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
				hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
				hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
				hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-132/212	119	125	1A	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	119	125	1A	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-182	146	152	m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-335	397	403	1A	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-34/449	79	85	1A	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-375	104	110	1A	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-377	180	186	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-431	150	156	1A	hsa-miR-431	UGUCUUGCAGGCCGUCAUGCA
miR-544	73	79	m8	hsa-miR-544	AUUCUGCAUUUUUAGCAAGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: PRKD1