Gene Page: PSEN2
Summary ?
GeneID | 5664 |
Symbol | PSEN2 |
Synonyms | AD3L|AD4|CMD1V|PS2|STM2 |
Description | presenilin 2 |
Reference | MIM:600759|HGNC:HGNC:9509|Ensembl:ENSG00000143801|HPRD:02860|Vega:OTTHUMG00000037563 |
Gene type | protein-coding |
Map location | 1q42.13 |
Sherlock p-value | 0.72 |
Fetal beta | -1.21 |
eGene | Meta |
Support | NEUROTROPHIN SIGNALING |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0687 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
IFI35 | 0.95 | 0.94 |
MT1E | 0.91 | 0.90 |
RTP4 | 0.90 | 0.84 |
PSMB9 | 0.90 | 0.93 |
B2M | 0.89 | 0.90 |
IFITM1 | 0.89 | 0.88 |
TAP1 | 0.87 | 0.83 |
RARRES3 | 0.87 | 0.92 |
OAS1 | 0.87 | 0.83 |
OASL | 0.87 | 0.83 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ANKRD17 | -0.68 | -0.79 |
MCM3AP | -0.68 | -0.81 |
EIF4ENIF1 | -0.68 | -0.79 |
MYO18A | -0.68 | -0.72 |
SFRS14 | -0.68 | -0.81 |
HEATR5B | -0.68 | -0.82 |
USP7 | -0.68 | -0.77 |
CKAP5 | -0.68 | -0.82 |
PDXDC1 | -0.67 | -0.78 |
SPTAN1 | -0.67 | -0.80 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 12297508 | |
GO:0008233 | peptidase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0042987 | amyloid precursor protein catabolic process | TAS | 15274632 | |
GO:0006509 | membrane protein ectodomain proteolysis | IDA | 15274632 | |
GO:0007220 | Notch receptor processing | TAS | 15274632 | |
GO:0008632 | apoptotic program | TAS | 8939861 | |
GO:0007059 | chromosome segregation | TAS | 9298903 | |
GO:0016485 | protein processing | IDA | 15274632 | |
GO:0043085 | positive regulation of catalytic activity | IDA | 15274632 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0000776 | kinetochore | TAS | 9298903 | |
GO:0005794 | Golgi apparatus | IDA | 15274632 | |
GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
GO:0005639 | integral to nuclear inner membrane | TAS | 9298903 | |
GO:0005783 | endoplasmic reticulum | IDA | 15274632 | |
GO:0016020 | membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | IDA | 15274632 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
APBA1 | D9S411E | MINT1 | X11 | X11A | X11ALPHA | amyloid beta (A4) precursor protein-binding, family A, member 1 | Affinity Capture-Western | BioGRID | 12196555 |
APBA2 | D15S1518E | HsT16821 | LIN-10 | MGC99508 | MGC:14091 | MINT2 | X11L | amyloid beta (A4) precursor protein-binding, family A, member 2 | Affinity Capture-Western | BioGRID | 12196555 |
APBA3 | MGC:15815 | X11L2 | mint3 | amyloid beta (A4) precursor protein-binding, family A, member 3 | Affinity Capture-Western | BioGRID | 12196555 |
APH1A | 6530402N02Rik | APH-1A | CGI-78 | anterior pharynx defective 1 homolog A (C. elegans) | - | HPRD,BioGRID | 12297508 |12471034 |
APH1B | APH-1B | DKFZp564D0372 | PRO1328 | PSFL | TAAV688 | anterior pharynx defective 1 homolog B (C. elegans) | - | HPRD | 12297508 |
APP | AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 | amyloid beta (A4) precursor protein | PS2 interacts with APP. | BIND | 9223340 |
BCL2L1 | BCL-XL/S | BCL2L | BCLX | Bcl-X | DKFZp781P2092 | bcl-xL | bcl-xS | BCL2-like 1 | - | HPRD,BioGRID | 10446169 |
CAPN1 | CANP | CANP1 | CANPL1 | muCANP | muCL | calpain 1, (mu/I) large subunit | - | HPRD,BioGRID | 9852298 |
CIB1 | CIB | KIP | KIP1 | SIP2-28 | calcium and integrin binding 1 (calmyrin) | - | HPRD,BioGRID | 10366599 |
CTNND2 | GT24 | NPRAP | catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) | - | HPRD | 10037471 |
DOCK3 | KIAA0299 | MOCA | PBP | dedicator of cytokinesis 3 | - | HPRD | 10854253 |
FHL2 | AAG11 | DRAL | SLIM3 | four and a half LIM domains 2 | - | HPRD,BioGRID | 11001931 |
FLNB | ABP-278 | AOI | DKFZp686A1668 | DKFZp686O033 | FH1 | FLN1L | LRS1 | SCT | TABP | TAP | filamin B, beta (actin binding protein 278) | - | HPRD,BioGRID | 9437013 |
GFAP | FLJ45472 | glial fibrillary acidic protein | Two-hybrid | BioGRID | 12058025 |
ICAM5 | TLCN | TLN | intercellular adhesion molecule 5, telencephalin | - | HPRD,BioGRID | 11719200 |
KCNIP3 | CSEN | DREAM | KCHIP3 | MGC18289 | Kv channel interacting protein 3, calsenilin | - | HPRD,BioGRID | 9771752 |
KCNIP4 | CALP | KCHIP4 | MGC44947 | Kv channel interacting protein 4 | - | HPRD,BioGRID | 11847232 |
METTL2B | FLJ11350 | FLJ12760 | METL | METTL2 | METTL2A | PSENIP1 | methyltransferase like 2B | - | HPRD,BioGRID | 11738826 |
NCSTN | APH2 | KIAA0253 | nicastrin | - | HPRD,BioGRID | 10993067 |
PSEN1 | AD3 | FAD | PS1 | S182 | presenilin 1 | Affinity Capture-Western | BioGRID | 12471034 |
PSENEN | MDS033 | MSTP064 | PEN-2 | PEN2 | presenilin enhancer 2 homolog (C. elegans) | - | HPRD,BioGRID | 12198112 |12639958 |
SRI | FLJ26259 | SCN | sorcin | - | HPRD,BioGRID | 10748169 |
UBQLN1 | DA41 | DSK2 | FLJ90054 | PLIC-1 | XDRP1 | ubiquilin 1 | - | HPRD,BioGRID | 11076969 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NOTCH SIGNALING PATHWAY | 47 | 35 | All SZGR 2.0 genes in this pathway |
KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
BIOCARTA HIVNEF PATHWAY | 58 | 43 | All SZGR 2.0 genes in this pathway |
PID LKB1 PATHWAY | 47 | 37 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ERBB4 | 90 | 67 | All SZGR 2.0 genes in this pathway |
REACTOME NUCLEAR SIGNALING BY ERBB4 | 38 | 30 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS | 27 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH4 | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH2 | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH3 | 12 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME REGULATED PROTEOLYSIS OF P75NTR | 10 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME NRIF SIGNALS CELL DEATH FROM THE NUCLEUS | 15 | 10 | All SZGR 2.0 genes in this pathway |
REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP | 59 | 38 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
HOEBEKE LYMPHOID STEM CELL DN | 86 | 59 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA DN | 146 | 94 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A TARGETS UP | 67 | 40 | All SZGR 2.0 genes in this pathway |
LIU CDX2 TARGETS UP | 36 | 22 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC TARGETS WITH EBOX | 230 | 156 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 2 | 30 | 23 | All SZGR 2.0 genes in this pathway |
LEE LIVER CANCER MYC TGFA DN | 65 | 44 | All SZGR 2.0 genes in this pathway |
UEDA PERIFERAL CLOCK | 169 | 111 | All SZGR 2.0 genes in this pathway |
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP | 78 | 56 | All SZGR 2.0 genes in this pathway |
ABRAHAM ALPC VS MULTIPLE MYELOMA DN | 19 | 14 | All SZGR 2.0 genes in this pathway |
TAKAO RESPONSE TO UVB RADIATION DN | 98 | 67 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
RAMASWAMY METASTASIS UP | 66 | 43 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 6 | 189 | 112 | All SZGR 2.0 genes in this pathway |
GAVIN FOXP3 TARGETS CLUSTER P3 | 160 | 103 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 DN | 245 | 150 | All SZGR 2.0 genes in this pathway |
HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE DN | 72 | 47 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-183 | 74 | 81 | 1A,m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-30-5p | 121 | 127 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.