Gene Page: PAK7
Summary ?
GeneID | 57144 |
Symbol | PAK7 |
Synonyms | PAK5 |
Description | p21 protein (Cdc42/Rac)-activated kinase 7 |
Reference | MIM:608038|HGNC:HGNC:15916|Ensembl:ENSG00000101349|HPRD:06423|Vega:OTTHUMG00000031857 |
Gene type | protein-coding |
Map location | 20p12 |
Pascal p-value | 0.731 |
Sherlock p-value | 0.668 |
Fetal beta | 1.226 |
DMG | 1 (# studies) |
eGene | Cerebellum |
Support | G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.046 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg18815779 | 20 | 9819789 | PAK7 | 9.87E-5 | -0.313 | 0.028 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005515 | protein binding | IPI | 17353931 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0006916 | anti-apoptosis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005739 | mitochondrion | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AP2S1 | AP17 | AP17-DELTA | CLAPS2 | adaptor-related protein complex 2, sigma 1 subunit | Affinity Capture-MS | BioGRID | 17353931 |
CCDC59 | BR22 | DKFZp686K1021 | FLJ10294 | HSPC128 | TAP26 | coiled-coil domain containing 59 | Affinity Capture-MS | BioGRID | 17353931 |
CDC42 | CDC42Hs | G25K | cell division cycle 42 (GTP binding protein, 25kDa) | - | HPRD,BioGRID | 11756552 |12032833 |
FHL3 | MGC19547 | MGC23614 | MGC8696 | SLIM2 | four and a half LIM domains 3 | Two-hybrid | BioGRID | 16189514 |
LZTS2 | KIAA1813 | LAPSER1 | leucine zipper, putative tumor suppressor 2 | Two-hybrid | BioGRID | 16189514 |
PDLIM7 | LMP1 | PDZ and LIM domain 7 (enigma) | Two-hybrid | BioGRID | 16189514 |
RAC1 | MGC111543 | MIG5 | TC-25 | p21-Rac1 | ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) | - | HPRD,BioGRID | 11756552 |
RPA3 | REPA3 | replication protein A3, 14kDa | Affinity Capture-MS | BioGRID | 17353931 |
S100A7 | PSOR1 | S100A7c | S100 calcium binding protein A7 | Affinity Capture-MS | BioGRID | 17353931 |
S100A9 | 60B8AG | CAGB | CFAG | CGLB | L1AG | LIAG | MAC387 | MIF | MRP14 | NIF | P14 | S100 calcium binding protein A9 | Affinity Capture-MS | BioGRID | 17353931 |
TUBGCP4 | 76P | FLJ14797 | GCP4 | tubulin, gamma complex associated protein 4 | Two-hybrid | BioGRID | 16189514 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG T CELL RECEPTOR SIGNALING PATHWAY | 108 | 89 | All SZGR 2.0 genes in this pathway |
KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
KEGG RENAL CELL CARCINOMA | 70 | 60 | All SZGR 2.0 genes in this pathway |
BIOCARTA AGR PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
SIG PIP3 SIGNALING IN CARDIAC MYOCTES | 67 | 54 | All SZGR 2.0 genes in this pathway |
SIG CHEMOTAXIS | 45 | 37 | All SZGR 2.0 genes in this pathway |
SIG REGULATION OF THE ACTIN CYTOSKELETON BY RHO GTPASES | 35 | 25 | All SZGR 2.0 genes in this pathway |
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
ST T CELL SIGNAL TRANSDUCTION | 45 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATION OF RAC | 14 | 11 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ROBO RECEPTOR | 30 | 26 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS A UP | 191 | 128 | All SZGR 2.0 genes in this pathway |
WONG IFNA2 RESISTANCE DN | 34 | 20 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
MEISSNER ES ICP WITH H3K4ME3 AND H3K27ME3 | 14 | 8 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN ICP WITH H3K4ME3 | 32 | 17 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF ICP WITH H3K4ME3 AND H3K27ME3 | 38 | 34 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS ICP WITH H3K4ME3 AND H327ME3 | 126 | 83 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 | 137 | 85 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
HOELZEL NF1 TARGETS DN | 115 | 73 | All SZGR 2.0 genes in this pathway |
GOBERT CORE OLIGODENDROCYTE DIFFERENTIATION | 40 | 28 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-10 | 311 | 317 | 1A | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
hsa-miR-10b | UACCCUGUAGAACCGAAUUUGU | ||||
miR-101 | 1993 | 1999 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-135 | 1422 | 1428 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-139 | 1337 | 1343 | m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
hsa-miR-139brain | UCUACAGUGCACGUGUCU | ||||
miR-144 | 1993 | 1999 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-145 | 1636 | 1643 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-15/16/195/424/497 | 1247 | 1253 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-17-5p/20/93.mr/106/519.d | 394 | 400 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-181 | 1267 | 1273 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-185 | 179 | 186 | 1A,m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
miR-186 | 584 | 591 | 1A,m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-191 | 284 | 290 | 1A | hsa-miR-191brain | CAACGGAAUCCCAAAAGCAGCU |
miR-200bc/429 | 1104 | 1111 | 1A,m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-208 | 165 | 171 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-24 | 748 | 754 | 1A | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-30-5p | 521 | 527 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-320 | 627 | 634 | 1A,m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-323 | 1220 | 1226 | m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-369-3p | 232 | 238 | 1A | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-374 | 232 | 238 | m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-375 | 539 | 545 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
miR-376c | 1811 | 1817 | 1A | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-495 | 1428 | 1434 | 1A | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-499 | 165 | 171 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
miR-543 | 1268 | 1274 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
miR-93.hd/291-3p/294/295/302/372/373/520 | 393 | 399 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.