Gene Page: BCAT2
Summary ?
GeneID | 587 |
Symbol | BCAT2 |
Synonyms | BCAM|BCATM|BCT2|PP18 |
Description | branched chain amino acid transaminase 2 |
Reference | MIM:113530|HGNC:HGNC:977|Ensembl:ENSG00000105552|HPRD:00217|Vega:OTTHUMG00000183327 |
Gene type | protein-coding |
Map location | 19q13 |
Pascal p-value | 0.037 |
Sherlock p-value | 0.095 |
eGene | Anterior cingulate cortex BA24 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs34867589 | 19 | 49300913 | BCAT2 | ENSG00000105552.10 | 1.64951E-6 | 0.03 | 13373 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ANXA5 | 0.75 | 0.78 |
LIX1 | 0.74 | 0.74 |
NXT2 | 0.74 | 0.64 |
SLC40A1 | 0.72 | 0.62 |
TSPAN12 | 0.70 | 0.73 |
SPATA6 | 0.70 | 0.71 |
ENKUR | 0.69 | 0.71 |
LHFPL3 | 0.69 | 0.61 |
SGCE | 0.69 | 0.72 |
FIBIN | 0.67 | 0.64 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NEUROD2 | -0.38 | -0.42 |
EMX1 | -0.38 | -0.48 |
IER5L | -0.37 | -0.42 |
MPPED1 | -0.37 | -0.41 |
GRM2 | -0.36 | -0.41 |
SCUBE1 | -0.36 | -0.44 |
TIAM2 | -0.35 | -0.35 |
SLA | -0.35 | -0.23 |
PRDM8 | -0.35 | -0.39 |
TMEM108 | -0.35 | -0.29 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004084 | branched-chain-amino-acid transaminase activity | IEA | glutamate (GO term level: 6) | - |
GO:0004084 | branched-chain-amino-acid transaminase activity | TAS | glutamate (GO term level: 6) | 9165094 |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0009081 | branched chain family amino acid metabolic process | IEA | - | |
GO:0009082 | branched chain family amino acid biosynthetic process | TAS | 8702755 | |
GO:0008152 | metabolic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005739 | mitochondrion | TAS | 9165094 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG VALINE LEUCINE AND ISOLEUCINE DEGRADATION | 44 | 26 | All SZGR 2.0 genes in this pathway |
KEGG VALINE LEUCINE AND ISOLEUCINE BIOSYNTHESIS | 11 | 8 | All SZGR 2.0 genes in this pathway |
KEGG PANTOTHENATE AND COA BIOSYNTHESIS | 16 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME BRANCHED CHAIN AMINO ACID CATABOLISM | 17 | 9 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST PRENEOPLASTIC DN | 55 | 33 | All SZGR 2.0 genes in this pathway |
CAIRO PML TARGETS BOUND BY MYC DN | 14 | 12 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST TUMORS 324 DN | 149 | 93 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK DN | 196 | 131 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
LIANG HEMATOPOIESIS STEM CELL NUMBER LARGE VS TINY DN | 45 | 24 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
ALCALA APOPTOSIS | 88 | 60 | All SZGR 2.0 genes in this pathway |
CHESLER BRAIN QTL CIS | 75 | 51 | All SZGR 2.0 genes in this pathway |
PENG GLUCOSE DEPRIVATION UP | 48 | 26 | All SZGR 2.0 genes in this pathway |
CHESLER BRAIN HIGHEST GENETIC VARIANCE | 37 | 21 | All SZGR 2.0 genes in this pathway |
NADLER OBESITY DN | 48 | 34 | All SZGR 2.0 genes in this pathway |
JAIN NFKB SIGNALING | 75 | 44 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 6 | 189 | 112 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 7 | 76 | 46 | All SZGR 2.0 genes in this pathway |
BAUS TFF2 TARGETS UP | 32 | 22 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND WITH H4K20ME1 MARK | 145 | 82 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 328 | 334 | 1A | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-122 | 148 | 154 | m8 | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
miR-146 | 277 | 283 | 1A | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
miR-182 | 349 | 355 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-25/32/92/363/367 | 84 | 91 | 1A,m8 | hsa-miR-25brain | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-32 | UAUUGCACAUUACUAAGUUGC | ||||
hsa-miR-92 | UAUUGCACUUGUCCCGGCCUG | ||||
hsa-miR-367 | AAUUGCACUUUAGCAAUGGUGA | ||||
hsa-miR-92bSZ | UAUUGCACUCGUCCCGGCCUC | ||||
miR-9 | 351 | 357 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 349 | 355 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.