SZGR2

Summary ?

GeneID	5921
Symbol	RASA1
Synonyms	CM-AVM\|CMAVM\|GAP\|PKWS\|RASA\|RASGAP\|p120\|p120GAP\|p120RASGAP
Description	RAS p21 protein activator 1
Reference	MIM:139150\|HGNC:HGNC:9871\|Ensembl:ENSG00000145715\|HPRD:00745\|Vega:OTTHUMG00000162605
Gene type	protein-coding
Map location	5q13.3
Pascal p-value	0.64
Sherlock p-value	0.678
Fetal beta	0.423
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.2213

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09490071	5	86564760	RASA1	2.7E-9	-0.022	1.95E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IPI	Neurotransmitter (GO term level: 4)	2157284 \|2176151
GO:0005099	Ras GTPase activator activity	TAS		2188736
GO:0019870	potassium channel inhibitor activity	NAS		1553544
GO:0051020	GTPase binding	IPI		2122974
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043524	negative regulation of neuron apoptosis	ISS	neuron (GO term level: 9)	-
GO:0001570	vasculogenesis	ISS		-
GO:0000910	cytokinesis	ISS		-
GO:0001953	negative regulation of cell-matrix adhesion	IDA		8344248
GO:0007242	intracellular signaling cascade	NAS		1581965
GO:0008360	regulation of cell shape	NAS		9113414
GO:0009790	embryonic development	ISS		-
GO:0051056	regulation of small GTPase mediated signal transduction	IEA		-
GO:0051252	regulation of RNA metabolic process	NAS		9113414
GO:0030833	regulation of actin filament polymerization	IDA		8344248
GO:0045768	positive regulation of anti-apoptosis	IDA		15542850
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001726	ruffle	IEA		-
GO:0005622	intracellular	IEA		-
GO:0005737	cytoplasm	NAS		2821624
GO:0005886	plasma membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	c-Abl interacts with GAP.	BIND	1383690
ALK	CD246 \| Ki-1 \| TFG/ALK	anaplastic lymphoma receptor tyrosine kinase	-	HPRD	9174053
ANXA6	ANX6 \| CBP68	annexin A6	-	HPRD,BioGRID	8798684 \|10571081
ANXA6	ANX6 \| CBP68	annexin A6	Annexin VI interacts with GAP.	BIND	10571081
ARHGAP1	CDC42GAP \| RHOGAP \| RHOGAP1 \| p50rhoGAP	Rho GTPase activating protein 1	-	HPRD	9034330
ARHGAP5	GFI2 \| RhoGAP5 \| p190-B	Rho GTPase activating protein 5	GAP interacts with p190. This interaction was modeled on a demonstrated interaction between human GAP and rat p190.	BIND	1689011 \|8344248 \|10769036
ARHGAP5	GFI2 \| RhoGAP5 \| p190-B	Rho GTPase activating protein 5	-	HPRD	8537347
AURKA	AIK \| ARK1 \| AURA \| AURORA2 \| BTAK \| MGC34538 \| STK15 \| STK6 \| STK7	aurora kinase A	RasGAP interacts with HsAIRK-1.	BIND	11976319
AURKB	AIK2 \| AIM-1 \| AIM1 \| ARK2 \| AurB \| IPL1 \| STK12 \| STK5	aurora kinase B	-	HPRD	11976319
AURKB	AIK2 \| AIM-1 \| AIM1 \| ARK2 \| AurB \| IPL1 \| STK12 \| STK5	aurora kinase B	RasGAP interacts with HsAIRK-2 in the RasGAP/HsAIRK-2/survivin complex.	BIND	11976319
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	BCR interacts with GAP. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and human GAP.	BIND	1383690
BIRC5	API4 \| EPR-1	baculoviral IAP repeat-containing 5	-	HPRD	11976319
CAV2	CAV \| MGC12294	caveolin 2	Affinity Capture-Western Reconstituted Complex	BioGRID	12091389
CD5	LEU1 \| T1	CD5 molecule	-	HPRD,BioGRID	9603468
CSF1R	C-FMS \| CD115 \| CSFR \| FIM2 \| FMS	colony stimulating factor 1 receptor	-	HPRD,BioGRID	2172781
CSK	MGC117393	c-src tyrosine kinase	-	HPRD,BioGRID	7544435
DNAJA3	FLJ45758 \| TID1 \| hTid-1	DnaJ (Hsp40) homolog, subfamily A, member 3	-	HPRD,BioGRID	11116152
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	-	HPRD,BioGRID	9008161
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	DOK1 interacts with RASGAP	BIND	10822173
DOK2	p56DOK \| p56dok-2	docking protein 2, 56kDa	Affinity Capture-Western	BioGRID	10822173
DOK2	p56DOK \| p56dok-2	docking protein 2, 56kDa	Dok2 interacts with RASGAP	BIND	10822173
DOK2	p56DOK \| p56dok-2	docking protein 2, 56kDa	-	HPRD	10508618 \|10799545
DOK4	FLJ10488	docking protein 4	-	HPRD	12730241
DOK4	FLJ10488	docking protein 4	IRS5/DOK4 interacts with RasGAP. This interaction was modelled on a demonstrated interaction between human IRS5/DOK4 and hamster RasGAP.	BIND	12730241
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Reconstituted Complex	BioGRID	8647858
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	GAP interacts with EGFR.	BIND	1385407 \|1850098 \|2176151
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD	1633149
EPHB2	CAPB \| DRT \| EPHT3 \| ERK \| Hek5 \| MGC87492 \| PCBC \| Tyro5	EPH receptor B2	-	HPRD,BioGRID	9233798 \|10644995
EPHB3	ETK2 \| HEK2 \| TYRO6	EPH receptor B3	-	HPRD,BioGRID	9674711
FES	FPS	feline sarcoma oncogene	-	HPRD,BioGRID	7691175
G3BP1	G3BP \| HDH-VIII \| MGC111040	GTPase activating protein (SH3 domain) binding protein 1	-	HPRD,BioGRID	9632780
GNB2L1	Gnb2-rs1 \| H12.3 \| HLC-7 \| PIG21 \| RACK1	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	RACK1 interacts with p120GAP.This interaction was modeled on a demonstrated interaction between RACK1 from mouse and rat, and human p120GAP.	BIND	11350068
GNB2L1	Gnb2-rs1 \| H12.3 \| HLC-7 \| PIG21 \| RACK1	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	-	HPRD,BioGRID	11350068
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	12441060
GRLF1	GRF-1 \| KIAA1722 \| MGC10745 \| P190-A \| P190A \| p190RhoGAP	glucocorticoid receptor DNA binding factor 1	Reconstituted Complex	BioGRID	9034330
HCK	JTK9	hemopoietic cell kinase	-	HPRD,BioGRID	7782336
HRAS	C-BAS/HAS \| C-H-RAS \| C-HA-RAS1 \| CTLO \| H-RASIDX \| HAMSV \| HRAS1 \| K-RAS \| N-RAS \| RASH1	v-Ha-ras Harvey rat sarcoma viral oncogene homolog	-	HPRD,BioGRID	7628625 \|9219684
HRAS	C-BAS/HAS \| C-H-RAS \| C-HA-RAS1 \| CTLO \| H-RASIDX \| HAMSV \| HRAS1 \| K-RAS \| N-RAS \| RASH1	v-Ha-ras Harvey rat sarcoma viral oncogene homolog	-	HPRD	2833817 \|7628625 \|8663024 \|9219684
HSPD1	CPN60 \| GROEL \| HSP60 \| HSP65 \| HuCHA60 \| SPG13	heat shock 60kDa protein 1 (chaperonin)	-	HPRD	1347942
HTT	HD \| IT15	huntingtin	HDP interacts with RasGAP.	BIND	9079622
HTT	HD \| IT15	huntingtin	-	HPRD,BioGRID	9079622
IGF1R	CD221 \| IGFIR \| JTK13 \| MGC142170 \| MGC142172 \| MGC18216	insulin-like growth factor 1 receptor	-	HPRD,BioGRID	7642582
INSR	CD220 \| HHF5	insulin receptor	-	HPRD,BioGRID	1331107
KDR	CD309 \| FLK1 \| VEGFR \| VEGFR2	kinase insert domain receptor (a type III receptor tyrosine kinase)	Affinity Capture-Western	BioGRID	10319320
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	-	HPRD,BioGRID	11604231
KHDRBS1	FLJ34027 \| Sam68 \| p62	KH domain containing, RNA binding, signal transduction associated 1	Sam68 interacts with the SH2 domains of p120GAP, preferentially with the C-terminal SH2 domain. This interaction was modelled based on a demonstrated interaction between rat proteins.	BIND	11604231
MAGI1	AIP3 \| BAIAP1 \| BAP1 \| MAGI-1 \| TNRC19 \| WWP3	membrane associated guanylate kinase, WW and PDZ domain containing 1	-	HPRD	9169421
MAP4K4	FLH21957 \| FLJ10410 \| FLJ20373 \| FLJ90111 \| HGK \| KIAA0687 \| NIK	mitogen-activated protein kinase kinase kinase kinase 4	-	HPRD,BioGRID	10669731
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD	10508618
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	Affinity Capture-Western	BioGRID	9233798
PAG1	CBP \| FLJ37858 \| MGC138364 \| PAG	phosphoprotein associated with glycosphingolipid microdomains 1	-	HPRD	10790433
PDE6D	PDED	phosphodiesterase 6D, cGMP-specific, rod, delta	-	HPRD	11786539
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	Activated PDGFR interacts with GAP. This interaction was modeled on a demonstrated interaction between human PDGFR and canine GAP.	BIND	2157284
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	N-terminal SH2 domain of GAP interacts with PDGFR. This interaction was modeled on a demonstrated interaction between GAP from human and PDGFR from an unspecified species.	BIND	1385407 \|2173144 \|7689724 \|8344248
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	-	HPRD,BioGRID	10697503 \|11896619
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	Autophosphorylated PDGFR interacts with GAP. This interaction was modelled on a demonstrated interaction between human PDGFR and GAP from an unspecified species.	BIND	8890167
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	-	HPRD	1336372
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	Affinity Capture-Western	BioGRID	9743338
PTK2B	CADTK \| CAKB \| FADK2 \| FAK2 \| FRNK \| PKB \| PTK \| PYK2 \| RAFTK	PTK2B protein tyrosine kinase 2 beta	-	HPRD,BioGRID	8798684 \|10708762 \|10713673
PTPRC	B220 \| CD45 \| CD45R \| GP180 \| LCA \| LY5 \| T200	protein tyrosine phosphatase, receptor type, C	-	HPRD	8570203
PXN	FLJ16691	paxillin	-	HPRD,BioGRID	10092539
RAB5A	RAB5	RAB5A, member RAS oncogene family	-	HPRD	11536198
RAP1A	KREV-1 \| KREV1 \| RAP1 \| SMGP21	RAP1A, member of RAS oncogene family	in vivo	BioGRID	2164710
SLC9A2	NHE2	solute carrier family 9 (sodium/hydrogen exchanger), member 2	-	HPRD,BioGRID	10187839
SOCS3	ATOD4 \| CIS3 \| Cish3 \| MGC71791 \| SOCS-3 \| SSI-3 \| SSI3	suppressor of cytokine signaling 3	-	HPRD,BioGRID	11331873
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	1717825
SYN1	SYN1a \| SYN1b \| SYNI	synapsin I	-	HPRD,BioGRID	10899172
WWP1	AIP5 \| DKFZp434D2111 \| Tiul1 \| hSDRP1	WW domain containing E3 ubiquitin protein ligase 1	-	HPRD	9169421
WWP2	AIP2 \| WWp2-like	WW domain containing E3 ubiquitin protein ligase 2	-	HPRD	9169421
YES1	HsT441 \| P61-YES \| Yes \| c-yes	v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1	-	HPRD,BioGRID	1544885
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	-	HPRD,BioGRID	7760813

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
BIOCARTA EGF PATHWAY	31	25	All SZGR 2.0 genes in this pathway
BIOCARTA HIVNEF PATHWAY	58	43	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1 PATHWAY	21	16	All SZGR 2.0 genes in this pathway
BIOCARTA INSULIN PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA PDGF PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA MET PATHWAY	37	30	All SZGR 2.0 genes in this pathway
BIOCARTA SPRY PATHWAY	18	15	All SZGR 2.0 genes in this pathway
BIOCARTA TCR PATHWAY	49	37	All SZGR 2.0 genes in this pathway
BIOCARTA TPO PATHWAY	24	17	All SZGR 2.0 genes in this pathway
PID FCER1 PATHWAY	62	43	All SZGR 2.0 genes in this pathway
PID BCR 5PATHWAY	65	50	All SZGR 2.0 genes in this pathway
PID AURORA B PATHWAY	39	24	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY	40	38	All SZGR 2.0 genes in this pathway
PID RET PATHWAY	39	29	All SZGR 2.0 genes in this pathway
PID ANGIOPOIETIN RECEPTOR PATHWAY	50	41	All SZGR 2.0 genes in this pathway
PID IL2 1PATHWAY	55	43	All SZGR 2.0 genes in this pathway
PID ERBB1 RECEPTOR PROXIMAL PATHWAY	35	29	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
PID VEGFR1 PATHWAY	26	23	All SZGR 2.0 genes in this pathway
PID SYNDECAN 2 PATHWAY	33	27	All SZGR 2.0 genes in this pathway
PID AURORA A PATHWAY	31	20	All SZGR 2.0 genes in this pathway
PID RAS PATHWAY	30	22	All SZGR 2.0 genes in this pathway
PID FAK PATHWAY	59	45	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY PDGF	122	93	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION	95	76	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP	305	185	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 UP	58	39	All SZGR 2.0 genes in this pathway
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP	126	72	All SZGR 2.0 genes in this pathway
SCHRAMM INHBA TARGETS DN	24	12	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN	483	336	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
DING LUNG CANCER EXPRESSION BY COPY NUMBER	100	62	All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION UP	38	25	All SZGR 2.0 genes in this pathway
TENEDINI MEGAKARYOCYTE MARKERS	66	48	All SZGR 2.0 genes in this pathway
ROSS AML OF FAB M7 TYPE	68	44	All SZGR 2.0 genes in this pathway
GRANDVAUX IRF3 TARGETS DN	19	14	All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA	176	122	All SZGR 2.0 genes in this pathway
HADDAD T LYMPHOCYTE AND NK PROGENITOR UP	78	56	All SZGR 2.0 genes in this pathway
PARK HSC MARKERS	44	31	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN	225	163	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS UP	206	118	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN	371	218	All SZGR 2.0 genes in this pathway
PAL PRMT5 TARGETS UP	203	135	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 11	57	40	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C1	24	14	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C5	46	36	All SZGR 2.0 genes in this pathway
GENTILE UV LOW DOSE DN	67	46	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN	314	188	All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP	125	89	All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN	92	64	All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING	510	309	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR DN	185	116	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
GYORFFY MITOXANTRONE RESISTANCE	57	35	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
IKEDA MIR30 TARGETS UP	116	87	All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL DN	146	88	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	105	112	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-132/212	473	479	m8	hsa-miR-212^SZ	UAACAGUCUCCAGUCACGGCC
miR-132/212	473	479	m8	hsa-miR-132^brain	UAACAGUCUACAGCCAUGGUCG
miR-145	415	421	m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-153	125	132	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	334	341	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-182	334	341	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-21	179	185	1A	hsa-miR-21^brain	UAGCUUAUCAGACUGAUGUUGA
miR-21	179	185	1A	hsa-miR-590	GAGCUUAUUCAUAAAAGUGCAG
miR-223	377	384	1A,m8	hsa-miR-223	UGUCAGUUUGUCAAAUACCCC
miR-24	238	244	m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-30-5p	700	707	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-31	78	85	1A,m8	hsa-miR-31	AGGCAAGAUGCUGGCAUAGCUG
miR-320	620	627	1A,m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-335	76	82	m8	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-342	118	124	m8	hsa-miR-342^brain	UCUCACACAGAAAUCGCACCCGUC
miR-374	517	523	1A	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-376	367	373	1A	hsa-miR-376a	AUCAUAGAGGAAAAUCCACGU
miR-376	367	373	1A	hsa-miR-376b	AUCAUAGAGGAAAAUCCAUGUU
miR-377	117	123	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-448	126	132	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-505	583	589	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-96	335	341	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC
miR-96	335	341	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RASA1