Gene Page: SCN2A
Summary ?
| GeneID | 6326 |
| Symbol | SCN2A |
| Synonyms | BFIC3|BFIS3|BFNIS|EIEE11|HBA|HBSCI|HBSCII|NAC2|Na(v)1.2|Nav1.2|SCN2A1|SCN2A2 |
| Description | sodium voltage-gated channel alpha subunit 2 |
| Reference | MIM:182390|HGNC:HGNC:10588|Ensembl:ENSG00000136531|HPRD:03133|Vega:OTTHUMG00000044172 |
| Gene type | protein-coding |
| Map location | 2q24.3 |
| Pascal p-value | 0.584 |
| Sherlock p-value | 0.3 |
| TADA p-value | 0.005 |
| Fetal beta | -1.823 |
| Support | EXCITABILITY G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| SCN2A | chr2 | 166187838 | A | G | NM_001040142 NM_001040142 NM_001040143 NM_001040143 NM_021007 NM_021007 | . . . . . . | intronic splice-acceptor-in2 intronic splice-acceptor-in2 intronic splice-acceptor-in2 | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005244 | voltage-gated ion channel activity | IEA | - | |
| GO:0005248 | voltage-gated sodium channel activity | TAS | 1325650 | |
| GO:0031402 | sodium ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006814 | sodium ion transport | TAS | 1325650 | |
| GO:0006811 | ion transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001518 | voltage-gated sodium channel complex | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME L1CAM INTERACTIONS | 86 | 62 | All SZGR 2.0 genes in this pathway |
| REACTOME INTERACTION BETWEEN L1 AND ANKYRINS | 23 | 19 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP | 85 | 54 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP | 182 | 110 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 10D UP | 194 | 122 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 DN | 281 | 186 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
| YAUCH HEDGEHOG SIGNALING PARACRINE UP | 149 | 85 | All SZGR 2.0 genes in this pathway |
| LE NEURONAL DIFFERENTIATION UP | 18 | 13 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 1735 | 1742 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-103/107 | 560 | 567 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
| hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
| miR-124.1 | 1812 | 1818 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 1812 | 1818 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-135 | 1326 | 1333 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
| miR-142-5p | 2096 | 2102 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-17-5p/20/93.mr/106/519.d | 1659 | 1665 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
| hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
| hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
| hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
| hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
| hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
| miR-182 | 93 | 99 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-200bc/429 | 1020 | 1026 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
| hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
| hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
| miR-214 | 234 | 240 | 1A | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-217 | 1018 | 1024 | 1A | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-218 | 1152 | 1158 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-30-5p | 439 | 445 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG | ||||
| hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
| hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
| hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
| hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
| miR-323 | 699 | 705 | m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
| miR-330 | 1091 | 1097 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
| miR-335 | 1042 | 1048 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
| miR-34/449 | 368 | 374 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-496 | 310 | 316 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
| hsa-miR-496 | AUUACAUGGCCAAUCUC | ||||
| miR-542-3p | 1251 | 1257 | m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
| miR-96 | 93 | 99 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.