Gene Page: SRR
Summary ?
| GeneID | 63826 |
| Symbol | SRR |
| Synonyms | ILV1|ISO1 |
| Description | serine racemase |
| Reference | MIM:606477|HGNC:HGNC:14398|Ensembl:ENSG00000167720|HPRD:10451|Vega:OTTHUMG00000090583 |
| Gene type | protein-coding |
| Map location | 17p13 |
| Pascal p-value | 4.714E-8 |
| Fetal beta | 1.148 |
| eGene | Anterior cingulate cortex BA24 Caudate basal ganglia Cerebellar Hemisphere Cerebellum Cortex Frontal Cortex BA9 Hypothalamus Myers' cis & trans Meta |
| Support | G2Cdb.humanPSD G2Cdb.humanPSP Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGC128 | Genome-wide Association Study | A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
CV:PGC128
| SNP ID | Chromosome | Position | Allele | P | Function | Gene | Up/Down Distance |
|---|---|---|---|---|---|---|---|
| rs4523957 | chr17 | 2208899 | TG | 1.04E-9 | intronic | SRR |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs16952025 | chr17 | 2116797 | SRR | 63826 | 0.06 | cis | ||
| rs17834563 | chr17 | 2172709 | SRR | 63826 | 0.03 | cis | ||
| rs1885987 | chr17 | 2203024 | SRR | 63826 | 0.09 | cis | ||
| rs3744270 | 17 | 2207326 | SRR | ENSG00000167720.8 | 4.01456E-7 | 0.01 | -3004 | gtex_brain_ba24 |
| rs12450028 | 17 | 2207425 | SRR | ENSG00000167720.8 | 3.91241E-7 | 0.01 | -2905 | gtex_brain_ba24 |
| rs77530532 | 17 | 2208874 | SRR | ENSG00000167720.8 | 6.20043E-7 | 0.01 | -1456 | gtex_brain_ba24 |
| rs116875739 | 17 | 2211001 | SRR | ENSG00000167720.8 | 1.20948E-6 | 0.01 | 671 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016853 | isomerase activity | IEA | - | |
| GO:0018114 | threonine racemase activity | IEA | - | |
| GO:0030170 | pyridoxal phosphate binding | IEA | - | |
| GO:0030378 | serine racemase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0008152 | metabolic process | IEA | - | |
| GO:0006563 | L-serine metabolic process | NAS | 11054547 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG GLYCINE SERINE AND THREONINE METABOLISM | 31 | 26 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER UP | 181 | 108 | All SZGR 2.0 genes in this pathway |
| APPIERTO RESPONSE TO FENRETINIDE UP | 38 | 26 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY NO BLOOD DN | 150 | 93 | All SZGR 2.0 genes in this pathway |
| ULE SPLICING VIA NOVA2 | 43 | 38 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY DN | 145 | 88 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 DN | 448 | 282 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-140 | 689 | 696 | 1A,m8 | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
| miR-146 | 669 | 675 | 1A | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
| hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
| miR-216 | 453 | 459 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
| miR-299-5p | 688 | 694 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-378* | 403 | 409 | m8 | hsa-miR-422b | CUGGACUUGGAGUCAGAAGGCC |
| hsa-miR-422a | CUGGACUUAGGGUCAGAAGGCC | ||||
| miR-421 | 941 | 947 | m8 | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.