SZGR2

Summary ?

GeneID	64412
Symbol	GZF1
Synonyms	ZBTB23\|ZNF336
Description	GDNF inducible zinc finger protein 1
Reference	MIM:613842\|HGNC:HGNC:15808\|Ensembl:ENSG00000125812\|HPRD:15778\|Vega:OTTHUMG00000032069
Gene type	protein-coding
Map location	20p11.21
Pascal p-value	0.958
Fetal beta	-0.149
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
Expression	Meta-analysis of gene expression	P value: 2.824

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg05533119	20	23343103	GZF1	4.17E-8	-0.007	1.16E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0005515	protein binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000122	negative regulation of transcription from RNA polymerase II promoter	IEA		-
GO:0001658	ureteric bud branching	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ZHOU INFLAMMATORY RESPONSE LIVE DN	384	220	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 DN	156	106	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA HIF1A DN	110	78	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A UP	142	104	All SZGR 2.0 genes in this pathway
SUH COEXPRESSED WITH ID1 AND ID2 UP	19	14	All SZGR 2.0 genes in this pathway
DING LUNG CANCER EXPRESSION BY COPY NUMBER	100	62	All SZGR 2.0 genes in this pathway
URS ADIPOCYTE DIFFERENTIATION UP	74	51	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	1663	1669	m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-124.1	390	396	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124.1	390	396	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	390	396	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-24*	590	596	m8	hsa-miR-189	GUGCCUACUGAGCUGAUAUCAGU
miR-30-5p	1598	1605	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-495	1719	1725	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-9	753	760	1A,m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GZF1