Gene Page: SLC4A3
Summary ?
| GeneID | 6508 |
| Symbol | SLC4A3 |
| Synonyms | AE3|SLC2C |
| Description | solute carrier family 4 member 3 |
| Reference | MIM:106195|HGNC:HGNC:11029|Ensembl:ENSG00000114923|HPRD:00109|Vega:OTTHUMG00000059238 |
| Gene type | protein-coding |
| Map location | 2q36 |
| Pascal p-value | 0.187 |
| Sherlock p-value | 0.99 |
| Fetal beta | -0.35 |
| DMG | 1 (# studies) |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg27310720 | 2 | 220506611 | SLC4A3 | 4.938E-4 | 0.421 | 0.047 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005452 | inorganic anion exchanger activity | IEA | - | |
| GO:0005452 | inorganic anion exchanger activity | TAS | 7923606 | |
| GO:0005215 | transporter activity | IEA | - | |
| GO:0008509 | anion transmembrane transporter activity | IEA | - | |
| GO:0015297 | antiporter activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006820 | anion transport | IEA | - | |
| GO:0006810 | transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005624 | membrane fraction | TAS | 7923606 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 7923606 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
| REACTOME SLC MEDIATED TRANSMEMBRANE TRANSPORT | 241 | 157 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSPORT OF INORGANIC CATIONS ANIONS AND AMINO ACIDS OLIGOPEPTIDES | 94 | 65 | All SZGR 2.0 genes in this pathway |
| BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| BASSO B LYMPHOCYTE NETWORK | 143 | 96 | All SZGR 2.0 genes in this pathway |
| NGUYEN NOTCH1 TARGETS UP | 29 | 23 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
| JI RESPONSE TO FSH UP | 74 | 56 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
| LIM MAMMARY STEM CELL UP | 489 | 314 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-122 | 227 | 233 | m8 | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
| miR-330 | 207 | 213 | 1A | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.