Gene Page: TIAL1
Summary ?
GeneID | 7073 |
Symbol | TIAL1 |
Synonyms | TCBP|TIAR |
Description | TIA1 cytotoxic granule-associated RNA binding protein-like 1 |
Reference | MIM:603413|HGNC:HGNC:11804|HPRD:04563| |
Gene type | protein-coding |
Map location | 10q |
Pascal p-value | 0.179 |
Sherlock p-value | 0.721 |
Fetal beta | 1.455 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003677 | DNA binding | NAS | - | |
GO:0003702 | RNA polymerase II transcription factor activity | TAS | 9207209 | |
GO:0003723 | RNA binding | TAS | 1326761 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006357 | regulation of transcription from RNA polymerase II promoter | TAS | 9207209 | |
GO:0006917 | induction of apoptosis | TAS | 1326761 | |
GO:0008150 | biological_process | ND | - | |
GO:0006952 | defense response | TAS | 1326761 | |
GO:0006915 | apoptosis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005575 | cellular_component | ND | - | |
GO:0005764 | lysosome | TAS | 1326761 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP | 206 | 111 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 2HR DN | 88 | 53 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
SCHLOSSER MYC TARGETS REPRESSED BY SERUM | 159 | 93 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION UP | 195 | 138 | All SZGR 2.0 genes in this pathway |
GOLDRATH HOMEOSTATIC PROLIFERATION | 171 | 102 | All SZGR 2.0 genes in this pathway |
YAGI AML RELAPSE PROGNOSIS | 35 | 24 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
MA MYELOID DIFFERENTIATION UP | 39 | 29 | All SZGR 2.0 genes in this pathway |
YAGI AML SURVIVAL | 129 | 87 | All SZGR 2.0 genes in this pathway |
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP | 314 | 201 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C2 | 54 | 39 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
ZHANG ANTIVIRAL RESPONSE TO RIBAVIRIN UP | 30 | 21 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 10HR UP | 101 | 69 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
CHENG RESPONSE TO NICKEL ACETATE | 45 | 29 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
MATZUK EMBRYONIC GERM CELL | 19 | 16 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S2 | 115 | 74 | All SZGR 2.0 genes in this pathway |
KYNG WERNER SYNDROM AND NORMAL AGING UP | 93 | 62 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
DELPUECH FOXO3 TARGETS DN | 41 | 27 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 AND SATB1 DN | 180 | 116 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 979 | 985 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-141/200a | 807 | 813 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-149 | 562 | 568 | 1A | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
miR-193 | 2082 | 2088 | 1A | hsa-miR-193a | AACUGGCCUACAAAGUCCCAG |
hsa-miR-193b | AACUGGCCCUCAAAGUCCCGCUUU | ||||
miR-200bc/429 | 338 | 344 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-203.1 | 694 | 701 | 1A,m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-363 | 1554 | 1560 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
miR-381 | 1148 | 1154 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.