Gene Page: GXYLT2
Summary ?
| GeneID | 727936 |
| Symbol | GXYLT2 |
| Synonyms | GLT8D4 |
| Description | glucoside xylosyltransferase 2 |
| Reference | MIM:613322|HGNC:HGNC:33383| |
| Gene type | protein-coding |
| Map location | 3p13 |
| Pascal p-value | 0.056 |
| TADA p-value | 0.009 |
| Fetal beta | -0.893 |
| DMG | 1 (# studies) |
| eGene | Caudate basal ganglia Cortex Nucleus accumbens basal ganglia Putamen basal ganglia Meta |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Montano_2016 | Genome-wide DNA methylation analysis | This dataset includes 172 replicated associations between CpGs with schizophrenia. | 1 |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| GXYLT2 | chr3 | 73004495 | T | A | NM_001080393 | p.283F>I | missense | Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg25338134 | 3 | 72940510 | GXYLT2 | 1.45E-4 | -0.006 | 0.139 | DMG:Montano_2016 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2322695 | 3 | 72983602 | GXYLT2 | ENSG00000172986.8 | 3.88E-7 | 0.01 | 46378 | gtex_brain_putamen_basal |
| rs884767 | 3 | 72983637 | GXYLT2 | ENSG00000172986.8 | 3.88E-7 | 0.01 | 46413 | gtex_brain_putamen_basal |
| rs13091160 | 3 | 73019583 | GXYLT2 | ENSG00000172986.8 | 7.106E-7 | 0.01 | 82359 | gtex_brain_putamen_basal |
| rs6793043 | 3 | 73020764 | GXYLT2 | ENSG00000172986.8 | 1.39E-6 | 0.01 | 83540 | gtex_brain_putamen_basal |
| rs9861719 | 3 | 73021850 | GXYLT2 | ENSG00000172986.8 | 6.988E-7 | 0.01 | 84626 | gtex_brain_putamen_basal |
| rs9862032 | 3 | 73022032 | GXYLT2 | ENSG00000172986.8 | 8.559E-7 | 0.01 | 84808 | gtex_brain_putamen_basal |
| rs13081565 | 3 | 73022662 | GXYLT2 | ENSG00000172986.8 | 9.109E-7 | 0.01 | 85438 | gtex_brain_putamen_basal |
| rs56105146 | 3 | 73022804 | GXYLT2 | ENSG00000172986.8 | 9.395E-7 | 0.01 | 85580 | gtex_brain_putamen_basal |
| rs9854358 | 3 | 73023153 | GXYLT2 | ENSG00000172986.8 | 9.951E-7 | 0.01 | 85929 | gtex_brain_putamen_basal |
| rs9830942 | 3 | 73023176 | GXYLT2 | ENSG00000172986.8 | 9.994E-7 | 0.01 | 85952 | gtex_brain_putamen_basal |
| rs7610454 | 3 | 73023667 | GXYLT2 | ENSG00000172986.8 | 1.011E-6 | 0.01 | 86443 | gtex_brain_putamen_basal |
| rs7646983 | 3 | 73023749 | GXYLT2 | ENSG00000172986.8 | 9.881E-7 | 0.01 | 86525 | gtex_brain_putamen_basal |
| rs1052278 | 3 | 73024350 | GXYLT2 | ENSG00000172986.8 | 4.988E-7 | 0.01 | 87126 | gtex_brain_putamen_basal |
| rs1108154 | 3 | 73024609 | GXYLT2 | ENSG00000172986.8 | 4.939E-7 | 0.01 | 87385 | gtex_brain_putamen_basal |
| rs2101614 | 3 | 73024724 | GXYLT2 | ENSG00000172986.8 | 2.278E-6 | 0.01 | 87500 | gtex_brain_putamen_basal |
| rs2087662 | 3 | 73024958 | GXYLT2 | ENSG00000172986.8 | 9.98E-7 | 0.01 | 87734 | gtex_brain_putamen_basal |
| rs7622433 | 3 | 73027175 | GXYLT2 | ENSG00000172986.8 | 1.039E-6 | 0.01 | 89951 | gtex_brain_putamen_basal |
| rs199907101 | 3 | 73028797 | GXYLT2 | ENSG00000172986.8 | 9.963E-7 | 0.01 | 91573 | gtex_brain_putamen_basal |
| rs71126815 | 3 | 73028804 | GXYLT2 | ENSG00000172986.8 | 1.895E-6 | 0.01 | 91580 | gtex_brain_putamen_basal |
| rs4428123 | 3 | 73030384 | GXYLT2 | ENSG00000172986.8 | 1.156E-6 | 0.01 | 93160 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016757 | transferase activity, transferring glycosyl groups | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME CHONDROITIN SULFATE DERMATAN SULFATE METABOLISM | 49 | 33 | All SZGR 2.0 genes in this pathway |
| REACTOME HEPARAN SULFATE HEPARIN HS GAG METABOLISM | 52 | 33 | All SZGR 2.0 genes in this pathway |
| REACTOME GLYCOSAMINOGLYCAN METABOLISM | 111 | 69 | All SZGR 2.0 genes in this pathway |
| REACTOME A TETRASACCHARIDE LINKER SEQUENCE IS REQUIRED FOR GAG SYNTHESIS | 25 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
| HOOI ST7 TARGETS DN | 123 | 78 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
| VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
| GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREY DN | 74 | 44 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 TARGETS DN | 260 | 143 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC2 TARGETS DN | 133 | 77 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR DN | 191 | 123 | All SZGR 2.0 genes in this pathway |
| LEE INTRATHYMIC T PROGENITOR | 21 | 14 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-29 | 93 | 99 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-377 | 78 | 85 | 1A,m8 | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.