SZGR2

Summary ?

GeneID	7546
Symbol	ZIC2
Synonyms	HPE5
Description	Zic family member 2
Reference	MIM:603073\|HGNC:HGNC:12873\|Ensembl:ENSG00000043355\|HPRD:04353\|Vega:OTTHUMG00000017279
Gene type	protein-coding
Map location	13q32
Pascal p-value	0.594
Sherlock p-value	0.244
Fetal beta	0.632
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg19272984	13	100636299	ZIC2	4.66E-9	-0.016	2.7E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16829545	chr2	151977407	ZIC2	7546	1.904E-4	trans
rs3845734	chr2	171125572	ZIC2	7546	0.01	trans
rs7584986	chr2	184111432	ZIC2	7546	3.031E-6	trans
rs9461864	chr6	33481468	ZIC2	7546	0.2	trans
rs16955618	chr15	29937543	ZIC2	7546	1.554E-11	trans
rs1041786	chr21	22617710	ZIC2	7546	0.06	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZNF3	0.97	0.94
SETDB1	0.96	0.93
SSRP1	0.96	0.93
RAF1	0.96	0.93
ZNF34	0.95	0.90
ZNF671	0.95	0.92
ZNF821	0.95	0.89
FAM48A	0.95	0.91
BAT1	0.95	0.91
MTA2	0.95	0.92

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.27	-0.78	-0.90
AF347015.31	-0.77	-0.89
HLA-F	-0.77	-0.77
MT-CO2	-0.76	-0.89
C5orf53	-0.76	-0.72
AIFM3	-0.75	-0.75
AF347015.33	-0.75	-0.86
MT-CYB	-0.74	-0.86
IFI27	-0.74	-0.85
S100B	-0.74	-0.80

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0005249	voltage-gated potassium channel activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007420	brain development	TAS	Brain (GO term level: 7)	9771712
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0006813	potassium ion transport	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-
GO:0008076	voltage-gated potassium channel complex	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG HEDGEHOG SIGNALING PATHWAY	56	42	All SZGR 2.0 genes in this pathway
WATANABE COLON CANCER MSI VS MSS UP	29	18	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN	460	312	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP	214	134	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN	1375	806	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
PEREZ TP53 AND TP63 TARGETS	205	145	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER UP	227	137	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A	100	63	All SZGR 2.0 genes in this pathway
BENPORATH ES 1	379	235	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN	103	64	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
NIELSEN GIST VS SYNOVIAL SARCOMA UP	19	12	All SZGR 2.0 genes in this pathway
LEE AGING CEREBELLUM DN	86	66	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1	528	324	All SZGR 2.0 genes in this pathway
LEIN CEREBELLUM MARKERS	85	47	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K9ME3 DN	120	71	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
NIELSEN SYNOVIAL SARCOMA UP	18	14	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN	841	431	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 DN	918	550	All SZGR 2.0 genes in this pathway
MAEKAWA ATF2 TARGETS	24	19	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-181	714	721	1A,m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-182	638	644	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-30-5p	738	744	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-485-3p	787	794	1A,m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-493-5p	959	966	1A,m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-494	940	946	m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-494	940	946	m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU
miR-505	1070	1077	1A,m8	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-543	938	944	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-96	637	644	1A,m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ZIC2