Gene Page: PTP4A1
Summary ?
GeneID | 7803 |
Symbol | PTP4A1 |
Synonyms | HH72|PRL-1|PRL1|PTP(CAAX1)|PTPCAAX1 |
Description | protein tyrosine phosphatase type IVA, member 1 |
Reference | MIM:601585|HGNC:HGNC:9634|Ensembl:ENSG00000112245|HPRD:03349|Vega:OTTHUMG00000014949 |
Gene type | protein-coding |
Map location | 6q12 |
Pascal p-value | 2.513E-5 |
Sherlock p-value | 0.673 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6826124 | chr4 | 200630 | PTP4A1 | 7803 | 0.2 | trans | ||
rs10886029 | chr10 | 118796011 | PTP4A1 | 7803 | 0.16 | trans | ||
rs7094283 | chr10 | 118818548 | PTP4A1 | 7803 | 0.15 | trans | ||
rs2118206 | chr10 | 118820499 | PTP4A1 | 7803 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MAN2B1 | 0.67 | 0.51 |
NHEJ1 | 0.64 | 0.50 |
B4GALT3 | 0.64 | 0.57 |
PCBP2 | 0.64 | 0.54 |
QARS | 0.64 | 0.55 |
CNN2 | 0.64 | 0.48 |
DCAKD | 0.63 | 0.59 |
SORD | 0.63 | 0.55 |
H1F0 | 0.62 | 0.52 |
APEX1 | 0.62 | 0.55 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.46 | -0.49 |
AF347015.27 | -0.45 | -0.52 |
AF347015.31 | -0.44 | -0.48 |
MT-CO2 | -0.44 | -0.49 |
MT-CYB | -0.42 | -0.48 |
AF347015.33 | -0.42 | -0.48 |
AF347015.8 | -0.42 | -0.47 |
AL139819.3 | -0.41 | -0.51 |
AF347015.21 | -0.41 | -0.54 |
S100B | -0.40 | -0.44 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004725 | protein tyrosine phosphatase activity | NAS | 10569806 | |
GO:0016787 | hydrolase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006470 | protein amino acid dephosphorylation | IEA | - | |
GO:0007049 | cell cycle | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0030335 | positive regulation of cell migration | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005819 | spindle | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005769 | early endosome | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID PRL SIGNALING EVENTS PATHWAY | 23 | 17 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN | 136 | 86 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE UP | 79 | 50 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS MAGENTA UP | 28 | 18 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
BIDUS METASTASIS UP | 214 | 134 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID WITH 7Q DELETION UP | 67 | 37 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
SNIJDERS AMPLIFIED IN HEAD AND NECK TUMORS | 37 | 27 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE NORMAL DN | 33 | 27 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE IMMORTALIZED DN | 31 | 26 | All SZGR 2.0 genes in this pathway |
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY DN | 110 | 64 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
UEDA PERIFERAL CLOCK | 169 | 111 | All SZGR 2.0 genes in this pathway |
BROCKE APOPTOSIS REVERSED BY IL6 | 144 | 98 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
HU GENOTOXIN ACTION DIRECT VS INDIRECT 24HR | 55 | 38 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
HENDRICKS SMARCA4 TARGETS DN | 53 | 34 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C0 | 107 | 72 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 12HR DN | 101 | 64 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
RIGGINS TAMOXIFEN RESISTANCE UP | 66 | 44 | All SZGR 2.0 genes in this pathway |
DE YY1 TARGETS DN | 92 | 64 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
LABBE TGFB1 TARGETS DN | 108 | 64 | All SZGR 2.0 genes in this pathway |
LIN NPAS4 TARGETS UP | 163 | 100 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
WANG RECURRENT LIVER CANCER DN | 16 | 9 | All SZGR 2.0 genes in this pathway |
GUTIERREZ MULTIPLE MYELOMA UP | 35 | 24 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS UP | 91 | 59 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN UP | 90 | 58 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 996 | 1003 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-130/301 | 717 | 723 | m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-138 | 1214 | 1220 | m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-141/200a | 1207 | 1213 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-144 | 1157 | 1163 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-150 | 1189 | 1195 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-182 | 347 | 353 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-19 | 716 | 722 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-203.1 | 449 | 455 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-218 | 360 | 366 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU | ||||
miR-26 | 1084 | 1090 | m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-29 | 2216 | 2223 | 1A,m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-5p | 501 | 508 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-339 | 739 | 745 | 1A | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
miR-380-5p | 1143 | 1149 | 1A | hsa-miR-380-5p | UGGUUGACCAUAGAACAUGCGC |
hsa-miR-563 | AGGUUGACAUACGUUUCCC | ||||
miR-381 | 369 | 376 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-450 | 996 | 1002 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
miR-96 | 346 | 353 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.