Gene Page: LRP8
Summary ?
GeneID | 7804 |
Symbol | LRP8 |
Synonyms | APOER2|HSZ75190|LRP-8|MCI1 |
Description | LDL receptor related protein 8 |
Reference | MIM:602600|HGNC:HGNC:6700|Ensembl:ENSG00000157193|HPRD:04002|Vega:OTTHUMG00000008924 |
Gene type | protein-coding |
Map location | 1p34 |
Pascal p-value | 0.003 |
Sherlock p-value | 0.141 |
Fetal beta | 1.255 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Meta |
Support | CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 3.9483 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg24107728 | 1 | 53760337 | LRP8 | 5.321E-4 | 0.589 | 0.048 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004888 | transmembrane receptor activity | TAS | 8626535 | |
GO:0030229 | very-low-density lipoprotein receptor activity | IDA | 8626535 | |
GO:0030227 | apolipoprotein E receptor activity | IDA | 8626535 | |
GO:0030227 | apolipoprotein E receptor activity | TAS | 11152697 | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0008034 | lipoprotein binding | IC | 11152697 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006508 | proteolysis | NAS | 11152697 | |
GO:0007165 | signal transduction | TAS | 10380922 | |
GO:0006629 | lipid metabolic process | NAS | 11152697 | |
GO:0006897 | endocytosis | IDA | 8626535 | |
GO:0019221 | cytokine-mediated signaling pathway | NAS | 11152697 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0016021 | integral to membrane | IC | 11152697 | |
GO:0005901 | caveola | IDA | 11369809 | |
GO:0005886 | plasma membrane | NAS | 10380922 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ANAPC10 | APC10 | DKFZp564L0562 | DOC1 | anaphase promoting complex subunit 10 | Two-hybrid | BioGRID | 10827173 |
APBA2 | D15S1518E | HsT16821 | LIN-10 | MGC99508 | MGC:14091 | MINT2 | X11L | amyloid beta (A4) precursor protein-binding, family A, member 2 | Two-hybrid | BioGRID | 10827173 |
APOE | AD2 | LPG | MGC1571 | apoprotein | apolipoprotein E | - | HPRD,BioGRID | 12167620 |12950167 |
APOH | B2G1 | BG | apolipoprotein H (beta-2-glycoprotein I) | - | HPRD,BioGRID | 12807892 |
CLU | AAG4 | APOJ | CLI | KUB1 | MGC24903 | SGP-2 | SGP2 | SP-40 | TRPM-2 | TRPM2 | clusterin | - | HPRD | 12824284 |
DAB1 | - | disabled homolog 1 (Drosophila) | - | HPRD | 10380922 |
DAB1 | - | disabled homolog 1 (Drosophila) | Two-hybrid | BioGRID | 10827173 |
DLG4 | FLJ97752 | FLJ98574 | PSD95 | SAP90 | discs, large homolog 4 (Drosophila) | Two-hybrid | BioGRID | 10827173 |
GIPC1 | C19orf3 | GIPC | GLUT1CBP | Hs.6454 | IIP-1 | MGC15889 | MGC3774 | NIP | RGS19IP1 | SEMCAP | SYNECTIIN | SYNECTIN | TIP-2 | GIPC PDZ domain containing family, member 1 | Two-hybrid | BioGRID | 10827173 |
ITGB1BP1 | DKFZp686K08158 | ICAP-1A | ICAP-1B | ICAP-1alpha | ICAP1 | ICAP1A | ICAP1B | integrin beta 1 binding protein 1 | Two-hybrid | BioGRID | 10827173 |
LRPAP1 | A2MRAP | A2RAP | HBP44 | MGC138272 | MRAP | RAP | low density lipoprotein receptor-related protein associated protein 1 | - | HPRD,BioGRID | 12899622 |
MAPK8IP1 | IB1 | JIP-1 | JIP1 | PRKM8IP | mitogen-activated protein kinase 8 interacting protein 1 | Two-hybrid | BioGRID | 10827173 |
MAPK8IP2 | IB2 | JIP2 | PRKM8IPL | mitogen-activated protein kinase 8 interacting protein 2 | Two-hybrid | BioGRID | 10827173 |
NOS1AP | 6330408P19Rik | CAPON | MGC138500 | nitric oxide synthase 1 (neuronal) adaptor protein | Two-hybrid | BioGRID | 10827173 |
RELN | PRO1598 | RL | reelin | - | HPRD,BioGRID | 10571240 |12167620 |12670700 |12899622 |
SCN3A | KIAA1356 | NAC3 | Nav1.3 | sodium channel, voltage-gated, type III, alpha subunit | Two-hybrid | BioGRID | 10827173 |
SNX17 | KIAA0064 | sorting nexin 17 | - | HPRD,BioGRID | 12169628 |
SYNJ2BP | ARIP2 | FLJ11271 | FLJ41973 | OMP25 | synaptojanin 2 binding protein | Two-hybrid | BioGRID | 10827173 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID REELIN PATHWAY | 29 | 29 | All SZGR 2.0 genes in this pathway |
PID LIS1 PATHWAY | 28 | 22 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET HOMEOSTASIS | 78 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET SENSITIZATION BY LDL | 16 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL UP | 285 | 181 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT EARLY DN | 6 | 5 | All SZGR 2.0 genes in this pathway |
ZHONG RESPONSE TO AZACITIDINE AND TSA DN | 70 | 38 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS DN | 310 | 188 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS RED UP | 17 | 13 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS UP | 135 | 82 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR DN | 209 | 122 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER | 140 | 73 | All SZGR 2.0 genes in this pathway |
MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
WEI MYCN TARGETS WITH E BOX | 795 | 478 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH PROLIFERATION | 147 | 80 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 240 HELA | 60 | 43 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
LEE TARGETS OF PTCH1 AND SUFU DN | 83 | 69 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS DN | 66 | 39 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC UP | 62 | 38 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA DN | 289 | 166 | All SZGR 2.0 genes in this pathway |
SCHUHMACHER MYC TARGETS UP | 80 | 57 | All SZGR 2.0 genes in this pathway |
URS ADIPOCYTE DIFFERENTIATION UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
HARRIS HYPOXIA | 81 | 64 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR DN | 47 | 31 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 24HR UP | 148 | 96 | All SZGR 2.0 genes in this pathway |
BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
DURCHDEWALD SKIN CARCINOGENESIS DN | 264 | 168 | All SZGR 2.0 genes in this pathway |
SANSOM APC TARGETS REQUIRE MYC | 210 | 123 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
YOKOE CANCER TESTIS ANTIGENS | 38 | 22 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D DN | 270 | 181 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL A DN | 18 | 7 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
IZADPANAH STEM CELL ADIPOSE VS BONE UP | 126 | 92 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
GRADE COLON AND RECTAL CANCER UP | 285 | 167 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN DN | 150 | 99 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
KARLSSON TGFB1 TARGETS UP | 127 | 78 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR UP | 229 | 149 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
GHANDHI DIRECT IRRADIATION UP | 110 | 68 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-130/301 | 238 | 245 | 1A,m8 | hsa-miR-130abrain | CAGUGCAAUGUUAAAAGGGCAU |
hsa-miR-301 | CAGUGCAAUAGUAUUGUCAAAGC | ||||
hsa-miR-130bbrain | CAGUGCAAUGAUGAAAGGGCAU | ||||
hsa-miR-454-3p | UAGUGCAAUAUUGCUUAUAGGGUUU | ||||
miR-148/152 | 1154 | 1160 | 1A | hsa-miR-148a | UCAGUGCACUACAGAACUUUGU |
hsa-miR-152brain | UCAGUGCAUGACAGAACUUGGG | ||||
hsa-miR-148b | UCAGUGCAUCACAGAACUUUGU | ||||
miR-330 | 423 | 429 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.